Información

¿Cuáles son los mecanismos responsables de la regulación a la baja o la pérdida de la expresión de MHC-1 en la superficie de las células cancerosas?

¿Cuáles son los mecanismos responsables de la regulación a la baja o la pérdida de la expresión de MHC-1 en la superficie de las células cancerosas?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

En general, se ha pensado que la regulación a la baja o la pérdida de la expresión de MHC-1 en la superficie de las células cancerosas está implicada en el mecanismo de escape inmunológico. Parece muy atractivo, pero no conozco los mecanismos de regulación a la baja o pérdida de MHC-1 en las células cancerosas. ¿Podrías decirme el mecanismo molecular?


No existe un mecanismo único (como era de esperar, ya que no existe una relación evolutiva entre los cánceres de diferentes individuos). Los mecanismos más comunes son varias formas de mutaciones, que van desde mutaciones puntuales en moléculas MHC individuales hasta grandes deleciones del locus MHC. Las mutaciones en genes implicados en el procesamiento de antígenos, que no forman parte del locus del MHC (por ejemplo, TAP, b2-microglobulina), también son bastante comunes. Los cambios epigenéticos tampoco son infrecuentes. Hay varias revisiones razonablemente recientes, que incluyen


Fronteras en inmunología

Las afiliaciones del editor y los revisores son las últimas proporcionadas en sus perfiles de investigación de Loop y es posible que no reflejen su situación en el momento de la revisión.


  • Descargar Articulo
    • Descargar PDF
    • ReadCube
    • EPUB
    • XML (NLM)
    • Suplementario
      Material
    • EndNote
    • Administrador de referencias
    • Archivo de TEXTO simple
    • BibTex


    COMPARTIR EN

    Resistencia a los fármacos en el cáncer: mecanismos y estrategias de abordaje

    La resistencia a los fármacos desarrollada hacia la terapia convencional es una de las razones importantes del fracaso de la quimioterapia en el cáncer. Los diversos mecanismos subyacentes para el desarrollo de farmacorresistencia en tumores incluyen heterogeneidad tumoral, algunos cambios en los niveles celulares, factores genéticos y otros mecanismos novedosos que se han destacado en los últimos años. En el escenario actual, los investigadores deben centrarse en estos nuevos mecanismos y sus estrategias de abordaje. Las pequeñas moléculas, péptidos y nanoterapéuticos han surgido para superar la resistencia a los fármacos en el cáncer. Los sistemas de administración de fármacos con resto de dirección mejoran la especificidad del sitio, la endocitosis mediada por receptores y aumentan la concentración del fármaco dentro de las células, minimizando así la resistencia al fármaco y mejorando su eficacia terapéutica. Estos enfoques terapéuticos funcionan modulando las diferentes vías responsables de la resistencia a los fármacos. Esta revisión se centra en los diferentes mecanismos de resistencia a los fármacos y los avances recientes en los enfoques terapéuticos para mejorar la sensibilidad y la eficacia de los quimioterápicos.

    Resumen gráfico

    Esta es una vista previa del contenido de la suscripción, acceda a través de su institución.


    Materiales y métodos

    Líneas celulares y condiciones de cultivo

    Después del consentimiento informado de los protocolos aprobados por la Junta de Revisión Institucional del Memorial Sloan Kettering Cancer Center (MSKCC), se obtuvieron células mononucleares de sangre periférica (PBMC) de donantes sanos con tipo HLA y pacientes mediante centrifugación de densidad Ficoll. Las fuentes para la obtención de las líneas celulares de mesotelioma humano JMN y Meso34 se describen previamente y se verificaron como líneas celulares únicas mediante secuenciación IMPACT (Tabla complementaria S1 ref. 3). HEK293T, PC9, SKMEL5, UACC257, SW480, CFPAC1, H827, H1975, H1299 y A549 se obtuvieron de ATCC entre los años 2012 y 2016 y no se validaron más. La célula TPC1 se obtuvo del laboratorio del Dr. James Fagin, donde la línea celular se validó mediante secuenciación IMPACT y se utilizó de 2014 a 2016 (MSKCC). La línea de melanoma B16-F10 se obtuvo originalmente de I. Fidler (MD Anderson Cancer Center) y se usó de 2015 a 2016, y no se validó más. Las líneas celulares se mantuvieron de 2 a 3 meses en RPMI suplementado con FBS al 10% y l-glutamina 2 mmol / L a menos que se indique lo contrario. Se cultivaron HEK293T en medio modificado de Dulbecco con FBS al 10% y 2 mmol / L de l-glutamina. Las células se revisaron regularmente para micoplasma.

    Las líneas celulares de mesotelioma HLA-A * 02: 01 positivas JMN y Meso34, junto con la línea celular de melanoma SK-MEL5, se utilizaron en el ensayo ADCC como diana. Los anticuerpos (3 μg / ml) ESKM (15), PRAME o su control de isotipo hIgG1 se incubaron con células diana y PBMC de donantes sanos frescos a diferentes proporciones efector / diana durante 6 horas, junto con las dosis indicadas de vehículo o trametinib en RPMI suplementado con 10% de FBS. Se recogió el sobrenadante y se midió la citotoxicidad mediante un ensayo de liberación de 51 Cr (Perkin Elmer).

    Ensayo de muerte clonogénica

    Las células B16F10 se trataron con DMSO al 0,1% o con trametinib 1 µmol / L durante 72 horas. Las células B16F10 (1 × 10 4) se utilizaron luego como dianas y in vitro- Células T Pmel activadas (5 × 10 4) como efectores aislados del bazo de ratones pmel (GP100) B6.Cg-Thy1a / Cy Tg (TcraTcrb) 8Rest / J (The Jackson Laboratory).

    Cribado de ARNi agrupado

    Se diseñó una biblioteca de ARNhc personalizada dirigida al complemento completo de 526 quinasas humanas utilizando predicciones DSIR adaptadas a miR30 refinadas con reglas de "sensor" (seis ARNhc por gen) y se construyó mediante la clonación por PCR de un conjunto de oligonucleótidos sintetizados en matrices personalizadas de 12k (Agilent Technologies y CustomArray) como se describió anteriormente (16). La lista de genes se obtuvo de la base de datos KinBase (http://kinase.com/human/kinome/) y se seleccionó manualmente. Después de la verificación de la secuencia, 3156 shRNA (5-6 por gen) se combinaron con shRNA de control positivo HLA-A- y control negativo Renilla-dirigidos a shRNA en concentraciones iguales en un grupo. Se utilizaron células de mesotelioma JMN que expresaban de forma estable el gen Tet-On rt-TA3. Este conjunto se subclonó en el vector TRMPV-Neo y se transdujo por triplicado en células de cáncer de mesotelioma JMN Tet-on utilizando condiciones que conducen predominantemente a una única integración retroviral y representan cada shRNA en un número calculado de al menos 1000 células (Fig. 1A). . Las células transducidas se seleccionaron durante 6 días usando G418 (1 mg / ml de Invitrogen) en cada pase se mantuvieron más de 3 x 107 células para preservar la representación de la biblioteca durante todo el experimento. Después de la inducción, se obtuvieron muestras T0 (∼3 × 10 7 células por réplica, norte = 3) y las células se cultivaron posteriormente en presencia de doxiciclina (2 μg / ml) para inducir la expresión de ARNhc. Después de 4 días (Tf), se clasificaron aproximadamente 3 x 106 células que expresan ARNhc (dsRed + / Venus +) para cada réplica usando un FACSAriaII (BD Biosciences). Las células DAPI-negativas, dsRed + / Venus + se clasificaron mediante FACS en tres poblaciones de BB7 baja, BB7 media y BB7 alta unión (Fig. 1). El ADN genómico de las muestras de Tf se aisló mediante dos rondas de extracción con fenol utilizando tubos PhaseLock (5 ') seguido de precipitación con isopropanol. Se generaron bibliotecas de plantillas de secuenciación profunda mediante amplificación por PCR de cadenas guía de ARNhc como se describió anteriormente (16). Las bibliotecas se analizaron en un analizador de genoma Illumina a una concentración final de 8 pmol / L. Se secuenciaron 50 nucleótidos de la hebra guía utilizando un cebador personalizado (miR30EcoRISeq, TAGCCCCTTGAATTCCGAGGCAGTAGGCA). Los hits con menos de 100 lecturas de Illumina HiSeq se eliminaron porque no estaban por encima del fondo.

    Detección de reguladores de quinasas de HLA de superficie. A, Se utilizó un vector retroviral shRNA inducible por TRMPV para la transducción de JMN (línea de mesotelioma humano positivo para HLA-A * 02: 01). TRE es el elemento que responde a Tet, que impulsa la expresión del fluoróforo dsRed y la horquilla shRNA. El promotor constitutivo de PGK impulsa el fluoróforo de Venus junto con el casete de resistencia a neomicina. B, Datos de citometría de flujo y transferencia de Western que muestran la caída de HLA-A usando un sistema retroviral TRMPV con un shRNA de control positivo para HLA-A02. El shRen es un shRNA de control negativo diseñado contra el Renilla gene. C, esquema que representa la tubería de flujo de trabajo para la pantalla de reguladores de superficie HLA-A. D, gráfico en cascada que muestra la distribución de las construcciones de ARNhc contra MAP2K1 y EGFR como diferencia logarítmica de veces entre la población clasificada BB7-alta y la población clasificada BB7-baja. MI, La eliminación del ARNhc de MAP2K1 y EGFR en células JMN las valida como un regulador negativo de HLA-A de superficie. BB7.2 es un mAb específico para HLA-A02. Se usó ARNhc contra Renilla como control negativo, mientras que se usó ARNhc contra HLA-A como control positivo. La pantalla se realizó por triplicado. Los experimentos de inhibición se realizaron al menos dos veces con resultados similares, y los datos mostrados son representativos. El estudiante t Se realizó una prueba para comparar cada MFI de eliminación del gen shRNA con el control shRen (*, ≤0.05 **, ≤0.01 ***, ≤0.001 ****, ≤0.0001).

    Se determinaron las representaciones relativas de cada ARNhc individual y se compararon en cada población clasificada dada. Separamos los hits fenotípicamente en reguladores negativos (la población 1 SD por debajo de la intensidad media de fluorescencia) o reguladores positivos (la población 1 SD por encima de la intensidad media de fluorescencia) de HLA-A * 02: 01. Se comparó la proporción de la clasificación de ARNhc entre la población alta y baja, indicando una proporción alta un regulador negativo putativo de HLA-A * 02: 01 de superficie. Los criterios de puntuación para que un gen sea un negativo El regulador de HLA-A * 02: 01 se basó en que dos o más construcciones de ARNhc puntuaran en el 5% superior para la diferencia de veces en la representación relativa entre la población alta de BB7 y la población baja de BB7, con otras construcciones puntuadas dentro de 1 DE del doblez medio cambio. Los productos génicos con al menos dos secuencias de ARNhc en la proporción superior del 5% se seleccionaron para su posterior validación mediante otros métodos. Se utilizó la misma canalización de descubrimiento para identificar positivo reguladores de HLA-A * 02: 01. Para la validación, se utilizó el vector de ARNhc LT3GEPIR (ref. 17 Tabla complementaria S2). Las células se transdujeron y seleccionaron con puromicina, luego se indujeron con doxiciclina (2 µg / ml) durante 96 horas antes de evaluar la expresión de BB7, W6 / 32, ESK o PRAME mediante citometría de flujo.

    Anticuerpos

    Los anticuerpos utilizados para la citometría de flujo y el análisis de transferencia Western se describen en la Tabla complementaria S3. Los anticuerpos monoclonales (mAb) utilizados para la citometría de flujo fueron específicos para HLA-A02 (BB7.2), pan-HLA-ABC (W6 / 32), péptido WT1 RMF unido a HLA-A02 (ESK1), péptido PRAME ALY unido a HLA -A02 (Pr20), H2-K b (AF6-88.5.5.3) y H2-Kq (KH114). Otros anticuerpos utilizados en este informe también se enumeran en la Tabla complementaria S3.

    PCR en tiempo real

    El ARN total se extrajo usando Qiagen RNA Easy Plus (Qiagen # 74134) después de que las células se trataron durante 48 horas con el inhibidor indicado. El ARN se convirtió en ADNc usando qScript cDNA SuperMix (Quanta Biosciences Gaithersburg). Los ensayos en tiempo real se realizaron utilizando sondas en tiempo real TaqMan (Life Technologies) para HLA-A humano (Hs01058806_g1), microgobulina beta-2 (β2M) (Hs00187842_m1), TAP1 (Hs00388677_m1), TAP2 (Hs00241060_m1) y TBP (Hs00427620_m1) con 50 ng de ADNc. Para la evaluación de la expresión génica mediante RT-PCR PerfeCTa. FastMix. II (Quanta), las reacciones se llevaron a cabo por triplicado usando condiciones de termociclado estándar (2 minutos a 50 ° C, 10 minutos a 95 ° C, 40 ciclos de 15 segundos a 95 ° C y 1 minuto a 60 ° C). Se usó TBP como control interno, y se usó el método ΔΔCT para los cálculos relativos del ARNm.

    Estudios basados ​​en promotores

    El promotor de luciferasa GLuc se obtuvo de Genecoepia (GeneCoepia Rockville) con el β2METRO promotor clonado corriente arriba de la enzima GLuc. La normalización se realizó a SEAP (bajo el promotor SV40 constitutivamente activo). Las células se sembraron a 5E3 células / pocillo y se trataron con los fármacos indicados durante 72 horas. La cuantificación de la luminiscencia se ensayó usando el kit de ensayo de luminiscencia dual Secrete-Pair (GeneCoepia Rockville).

    Estudios de citometría de flujo

    Las líneas celulares se sembraron por triplicado en una placa de cultivo tisular de 6 pocillos a una densidad de 1E5 células / pocillo y se dejaron adherir durante la noche. Al día siguiente, las células se trataron con vehículo de control (DMSO al 0,1%), fármacos o inhibidores a las concentraciones indicadas. A continuación, las células se aislaron 72 horas después del tratamiento con inhibidor y se lavaron con PBS. Posteriormente, las células se tiñeron con BB7.2 (mAb específico de HLA-A02), W6 / 32 (mAb específico de HLA-ABC) o AF6-88.5.5.3 (mAb específico de H2-K b Ebiosciences). Las células se tiñeron con yoduro de propidio para determinar su viabilidad. Las células se analizaron en un citómetro de flujo BD Accuri C6.

    Sobreexpresión de β2METRO

    Β humano2Se clonó ADNc M en el vector MSCV Puromicina.

    Sobreexpresión de EGFR y NRAS mutantes

    El vector retrovírico pBABE que codifica EGFR que alberga la mutación L858R se usó para transducir de manera estable la línea celular H1299 usando células HEK293T / anfóteras y se seleccionaron en puromicina (2,5 µg / ml) durante 5 días. EGFR L858R fue un regalo de Matthew Meyerson, (Dana-Farber Cancer Institute, Boston, Massachusetts) (plásmido Addgene nº 11012).

    Para la sobreexpresión de NRAS, se utilizó el plásmido pBABE NRAS Q61K para transducir células H827 de forma similar a la descrita anteriormente y seleccionadas en puromicina (2 µg / ml). pBabe N-Ras 61K fue un regalo de Channing Der (plásmido Addgene nº 12543).

    Estudios de inhibidores de moléculas pequeñas

    Los compuestos se obtuvieron de SelleckChem. Los fármacos se utilizaron en dosis subcitostáticas mediante titulación utilizando el ensayo Cell Titer Glo (Promega). Se usaron todas las drogas in vitro a las dosis indicadas en DMSO al 1%. Los experimentos se realizaron al menos dos veces con resultados similares y los datos que se muestran son representativos.

    Caída de ARNip

    La línea celular JMN se trató con un ARNip codificado de control o ARNip contra STAT1, STAT3 y RelA. Las células se trataron con el fármaco indicado 24 horas después de la eliminación del ARNip durante 72 horas antes de analizar el HLA-A de superficie mediante citometría de flujo. Los detalles de la construcción de ARNhc se proporcionan en la Tabla complementaria S2.

    Modelo de ratón transgénico EGFR L858R

    Se obtuvieron ratones FVB CC10-rtTA / EGFR-L858R como un amable obsequio del laboratorio Harold Varmus (Weill Cornell Medicine). Los ratones se criaron de acuerdo con la junta de revisión institucional de MSKCC según el protocolo 96-11-044. Los ratones usados ​​para el experimento eran heterocigotos para CC10-rtTA y EGFR-L858R detectados por genotipado cuantitativo por PCR. A las 4 a 6 semanas de edad, los ratones recibieron doxiciclina a través de gránulos de comida (625 mg / kg de Harlan-Teklad) durante & gt6 semanas. Se obtuvieron imágenes de los ratones anestesiando con isoflurano al 2% y las imágenes del campo pulmonar se adquirieron en un escáner Bruker 4.7T Biospec (Bruker Biospin Inc.) de resonancia magnética (MRI) en el núcleo de imágenes de animales pequeños en el MSKCC. Las imágenes se analizaron con Osirix Imaging Software. Se confirmó que el cáncer de pulmón en ratones tiene apariencia reticulonodular y consolidaciones mediante imágenes de RM axiales y coronales, en consonancia con los datos anteriores publicados sobre los ratones transgénicos (18).

    Los ratones se sacrificaron una vez que se confirmó que tenían tumores pulmonares (también se usaron ratones de control no inducidos, que genotípicamente eran idénticos pero no recibieron dieta dox). Los pulmones se aislaron y trataron con colagenasa IV en HBSS con Ca 2+ y Mg 2+ durante 1 hora a 37ºC. A continuación, se recogieron las células, se bloquearon con bloque FcR de ratón (Miltenyi), se contaron y se tiñeron con anticuerpos CD45 de ratón (30-F11 Biolegend), EGFR humano (AY13 clon Biolegend) y H2-Kq de ratón (KH114, clon Abcam). El análisis de citometría de flujo se realizó en Fortessa (BD Biosciences).

    Datos de microarrays CC10 / L858R

    Los datos de expresión de tejido aislado de ratones transgénicos WT y EGFR L858R se obtuvieron de un estudio anterior (GSE17373) y se seleccionaron para datos estadísticamente significativos (PAG & lt 0.05) para PDCD1 (PD-1), CD274 (PD-L1), TAP1, TAP2, H2-K d , y β2M expresión génica entre tejido pulmonar EGFR L858R portador de tumor y tejido pulmonar normal (19, 20).


    Los mecanismos de expresión desregulada de miARN

    La expresión anormal de miARN podría inducir la transformación maligna de células o hacer que las células tumorales sean resistentes a los fármacos de quimioterapia. A continuación, revisaremos los mecanismos de desregulación de la expresión de miARN en células farmacorresistentes. Obviamente, estudiar los mecanismos de la desregulación de miARN nos ayudará a superar la resistencia a los medicamentos. Según los resultados de los estudios actuales, el mecanismo de desregulación de miARN incluyó principalmente la amplificación o deleción del gen de miARN, la regulación epigenética, la desregulación de factores de transcripción y la desregulación de genes / proteínas clave de la biogénesis y el procesamiento de miARN [19]. Además, el ARN endógeno competitivo (ARNc) también podría reducir la cantidad de miARN intracelular, uniéndose competitivamente a los miARN, como se ilustra en la Fig. 2.

    Los mecanismos de expresión desregulada de microARN. Diferentes mecanismos pueden promover o / e inhibir la expresión de miARN

    Amplificación y deleción de genes

    Las ubicaciones de aproximadamente el 50% de todos los genes de miARN humanos se encuentran en regiones frágiles o sitios asociados al cáncer, como la región mínima de deleción, amplificación y puntos de corte de translocación [16]. Los genes de estos sitios suelen ser más propensos a la deleción, la translocación o la amplificación. Por ejemplo, las deleciones en el cromosoma 13q14 se observaron con mayor frecuencia en anomalías cromosómicas. Se ha demostrado que tanto el miARN-15a como el miARN-16-1 se localizan dentro de 13q14 y con frecuencia se eliminan y / o regulan negativamente en más de la mitad de las leucemias linfocíticas crónicas (LLC) [115]. Un ejemplo opuesto fue el miRNA-17

    92, que se encuentra dentro de la región 13q31-q32. Se observó que esta región se amplifica en una variedad de tumores, lo que condujo a un aumento en la cantidad de miARN maduros, promoviendo así el desarrollo de tumores [116].

    Las investigaciones sobre la relación entre la desregulación de la resistencia a los fármacos asociada a los miARN y la amplificación y deleción de genes son aún raras. Los estudios han indicado que los niveles de expresión de miARN-219-2 y miARN-199b se asociaron con el pronóstico y el efecto del tratamiento de imatinib en pacientes con LMC. La disminución de la expresión de miARN-199b podría hacer que los pacientes con LMC fueran resistentes al imatinib [117]. Aproximadamente el 15-18% de los pacientes con LMC mostraron deleciones de genes alrededor de los puntos de corte de translocación en el cromosoma der (9) [118]. Varios estudios han demostrado que una deleción en 9q al mismo tiempo de la translocación Ph es relevante para la expresión de la bcr-abl gen de fusión. Se encontró que miRNA-219-2 y miRNA-199b mapean centromérico al abl1 gen dentro de la región cromosómica en 9q34 que con frecuencia se perdía en pacientes con LMC con deleciones der (9), la expresión disminuida inducida de miARN-199b y miARN-219-2, lo que resultó en la resistencia de la LMC a imatinib [117, 119].

    Se informó que el miARN-21 se incrementó en varios cánceres, y esto podría promover la resistencia a los fármacos de las células tumorales (Tabla 1). Hirata y col.[120] demostró que la sobreexpresión de miARN-21 en el cáncer de ovario era causada por la amplificación de la región cromosómica 17q23-25, que conducía a una baja expresión de PTEN (el gen diana del miARN-21). Chaluvally-Raghavan y col. [121] demostró directamente la relación entre la amplificación del gen de miARN y la resistencia a los fármacos tumorales. Descubrieron que el miARN-569, que estaba sobreexpresado en un subconjunto de cánceres de ovario y de mama, se debía al menos en parte a la amplificación de 3q26.2. Regulación a la baja de la proteína tumoral proteína nuclear inducible p53 1 (TP53INP1) la expresión inducida por miARN-569 contribuyó a los efectos de miARN-569 sobre la supervivencia y proliferación celular. Dirigirse al miARN-569 sensibiliza las células de cáncer de ovario y de mama al CDDP al aumentar la muerte celular tanto in vitro como in vivo. Como se mencionó anteriormente, la regulación positiva del miARN-17

    La familia 92 estaba relacionada con la amplificación de genes, y esto resultó en la promoción de la resistencia a los medicamentos en muchos tipos de tumores (Tabla 1). Hayashita y col. [122] encontró que el miARN-17

    92, que comprende siete miARN y reside en el intrón 3 del C13orf25 gen en 13q31.3, se sobreexpresó notablemente en los cánceres de pulmón, especialmente con la histología del cáncer de CPCP. La amplificación de esta región es la causa directa de la sobreexpresión de la familia de miARN-17, que potencia el crecimiento de las células cancerosas de pulmón.

    Modificaciones de metilación e histonas de genes de miARN

    La metilación del ADN y las modificaciones de histonas pueden alterar la expresión génica sin alterar la secuencia del ADN. La metilación del ADN se refiere a la adición de un grupo metilo (-CH3) al anillo de citosina de un dinucleótido CpG en la posición del carbono-5, que es catalizado por metiltransferasas de ADN (DNMT) [123]. La metilación del ADN conduce al silenciamiento de genes y sirve como un mecanismo alternativo de inactivación de genes. Las modificaciones postraduccionales como la acetilación, metilación y fosforilación ocurren en las colas de histonas aminoterminales y están fuertemente asociadas con la transcripción activa de genes o la represión transcripcional [124]. Generalmente, la acetilación de histonas por histona acetiltransferasa (HAT) está asociada con la activación de genes, y la hipoacetilación por histonas desacetilasas (HDAC) está asociada con la inactivación de genes. La metilación de histonas está asociada tanto con la activación como con el silenciamiento de genes. Por ejemplo, la tri-metilación de lisina 27 de la histona H3 (H3K27) es una marca de silenciamiento, y se encontró metilación de lisina 4 (H3K4) en los promotores de genes activos [125]. La metilación del ADN y las modificaciones de las histonas son los mecanismos epigenéticos que conducen a la desregulación de la expresión de miARN en los cánceres. Existe un papel colaborativo entre la metilación del ADN y las modificaciones de las histonas en el silenciamiento de los miARN supresores de tumores en el cáncer [123].

    Se creía que el miARN-34a era un miARN supresor de tumores, estaba regulado a la baja en muchos tipos de células tumorales y tenía el efecto de mejorar la sensibilidad de las células tumorales a los fármacos quimioterapéuticos (Tabla 1). Lodygin y col. [126] demostró que la pérdida de expresión de miARN-34a asociada con la metilación de su promotor en la isla CpG estaba presente en la mayoría (79,1%) de las muestras de carcinoma de próstata primario. Posteriormente, se encontró metilación frecuente del promotor miARN-34a en muestras de melanoma primario (62,5%), melanoma (43,2%), vejiga (33,3%), pulmón (29,1%), mama (25,0%), riñón (21,4%) , líneas celulares de cáncer de páncreas (15,7%) y de colon (13,0%). En NSCLC, Gallardo et al. [127] demostró que la expresión de miARN-34a se redujo significativamente en pacientes con hipermetilación de miARN-34a en comparación con la de pacientes con miARN-34a no metilado.

    MiRNA-320a se redujo a menudo en las células tumorales. En las células quimiorresistentes, la regulación a la baja de miR-320a se asoció con la metilación del promotor de la secuencia codificante de miR-320a [33]. Saito y col. [128] encontró que el tratamiento combinado de células cancerosas de vejiga humana con el reactivo de desmetilación 5-aza-2′-desoxicitidina (5-Aza-CdR) y el inhibidor de HDAC ácido 4-fenilbutírico (PBA) tiene un efecto significativo en la expresión de miARN. Podría elevar la expresión de miARN, incluido miARN-127. Otro ejemplo de regulación de metilación en miARN asociado a la resistencia a fármacos es miARN-149. MiRNA-149 se reguló negativamente y participó en la quimiorresistencia en células de cáncer de mama humano resistentes a ADM (MCF-7 / ADM). La regulación a la baja de miARN-149 se relacionó con la hipermetilación de su 5'-UTR. Con miARN-149 regulado a la baja, el gen diana GlcNAc N-desacetilasa / N-sulfotransferasa-1 (NDST1) se expresó al alza, por lo que aumentó la resistencia de las células de cáncer de mama humano MCF-7 a la ADM [28]. Yang y col. [85] encontraron que el miARN-130b estaba regulado a la baja en las células de cáncer de ovario resistentes a múltiples fármacos. Se encontró hipermetilación de miARN-130b en tejidos de cáncer de ovario, así como en líneas celulares resistentes a fármacos, y el nivel de metilación se correlacionó negativamente con su expresión. La desmetilación con 5-Aza-CdR condujo a la reactivación de la expresión de miARN-130b en líneas celulares de cáncer de ovario resistentes a fármacos, aumentando así la sensibilidad celular a CDDP y taxol. Una evidencia más intuitiva fue que la metilación de la isla CpG de miR-129-5p en células de cáncer gástrico redujo la expresión de miR-129-5p y provocó que las células adquirieran resistencia a los fármacos. En comparación con la expresión en las células madre, la expresión de miR-129-5p se restauró en una línea celular multirresistente tratada con un 5-Aza-CdR [129].

    Como se mencionó anteriormente, el miARN-21 es un miARN cancerígeno en varios tejidos, y su regulación positiva puede promover el desarrollo de tumores y la quimiorresistencia. Song y col. [130] recopilaron retrospectivamente 41 casos de pacientes con cáncer de páncreas avanzado que eran sensibles o resistentes a la gemcitabina (GEM) y evaluaron los niveles de miARN-21 circulante en suero para determinar una correlación con la actividad citotóxica. La acetilación de histonas en el promotor de miARN-21 también se estudió en células de adenocarcinomas ductales pancreáticos (PDAC) sensibles a GEM y resistentes a GEM. Descubrieron que los niveles de acetilación de histonas en el promotor de miARN-21 aumentaron en las células PDAC después del tratamiento con GEM, y la regulación al alza de miARN-21 inducida por la acetilación de histonas en la zona del promotor se asoció con quimiorresistencia a GEM y mayor potencial maligno en células de cáncer de páncreas. . Además, el miARN-214, que inhibía el desarrollo del cáncer de cuello uterino, se redujo mediante la metilación del ADN y la desacetilación de histonas, lo que provocó tumorigénesis y resistencia a los fármacos [111]. Otros ejemplos fueron miARN-375 y miARN-200. Los estudios demostraron que la expresión de estos dos miARN estaba regulada a la baja en las células de cáncer de mama resistentes a los medicamentos. Un tratamiento con un agente de desmetilación, en combinación con un inhibidor de HDAC, podría restaurar la expresión de estos miARN en las células [131, 132].

    Anormalidad de los factores de transcripción.

    Los factores de transcripción, también conocidos como factores de acción trans, son proteínas que pueden unirse específicamente a elementos que actúan en cis en la región promotora de un gen eucariota, activando o inhibiendo la transcripción génica, directamente o con la ayuda de otras proteínas.

    El factor de transcripción más conocido en la regulación de miARN es p53. P53 puede funcionar como supresor de tumores y su expresión se regula al alza cuando el ADN se ha dañado. Está asociado con la regulación de cientos de genes. En 2007, varios laboratorios anunciaron casi simultáneamente que la familia de miARN-34, incluido el miARN-34a, era un objetivo directo de p53, y esta molécula podría aumentar significativamente la regulación [133]. MiRNA-34a, que generalmente se considera un miRNA supresor de tumores, mejora la sensibilidad de las células tumorales a los fármacos quimioterapéuticos. P53 reconoce directamente a los promotores de la familia de miARN-34 y activa la transcripción de estos miARN [134]. Dos factores de transcripción asociados con p53, p63 y p73 exhiben funciones distintas en las células. P73 media la quimiosensibilidad, mientras que p63 promueve la proliferación y supervivencia celular. Ory y col. [135] mostró que p63 y p73 podrían regular la expresión de miARN-193a-5p. MiARN-193a-5p, cuya expresión fue reprimida por p63, fue activado por isoformas proapoptóticas de p73 tanto en células normales como en células tumorales in vivo. La quimioterapia provocó la inducción de este miARN dependiente de p63 / p73, limitando así la quimiosensibilidad debida a la inhibición por retroalimentación de p73 mediada por miARN. Es importante destacar que la inhibición del miARN-193a interrumpió esta retroalimentación y, por lo tanto, suprimió la viabilidad de las células tumorales e indujo una quimiosensibilidad espectacular tanto in vitro como in vivo. Otro estudio [136] informó que el miembro de la familia p53 y la isoforma p63, ΔNp63α, promovían la transcripción del miARN-205 y controlaban la EMT en las células cancerosas de vejiga humana. La caída de ΔNp63α reducía la expresión de las formas primarias y maduras del miARN-205 y del miARN -205 gen "huésped" (miARN-205HG), y disminuyó la unión de RNA Pol II a la miARN-205HG promotor, inhibidor miARN-205HG transcripción.

    Otro miARN asociado a la resistencia a fármacos, el miARN-125b, está regulado por múltiples factores de transcripción. En el linfoma cutáneo de células T, la sobreexpresión de c-Myc transcripción de miARN-125b-5p reprimida y células de linfoma sensibilizadas a bortezomib [137]. Sin embargo, la sobreexpresión de Caracol aumentó drásticamente la expresión de miARN-125b a través del eje Wnt / β-catenina / TCF4 activado por Snail. Snail confirió quimiorresistencia reprimiendo Bak1 mediante la regulación positiva de miARN-125b. Se ha informado que el receptor gamma activado por proliferador de peroxisomas (PPARγ), un factor de transcripción funcional múltiple, tiene efectos antitumorales mediante la inhibición de la proliferación y la inducción de diferenciación y apoptosis. Luo y col. [138] demostró que PPARγ podría promover la expresión de miR-125b al unirse directamente al elemento sensible en la región promotora del gen miRNA-125b.

    Otros miARN relacionados con la quimiorresistencia, como miARN-320a, miARN-155, miARN-200 y miARN-21, fueron regulados por factores de transcripción v-ets eritroblastosis virus E26 oncogén homólogo 1 (ETS-1) [33], Smad4 [ 139], achaete en forma de escudo 2 (Ascl2) [140] y factor de tipo Krüppel 9 (KLF9) [141], respectivamente, como se muestra en la Fig. 2.

    Desregulación de la biogénesis y el procesamiento de miARN

    El proceso de biogénesis y maduración de miARN se muestra en la Fig. 1. Toda la vía requiere una serie de enzimas y proteínas clave, incluidas dos endonucleasas de ARN III, Drosha y Dicer1, el cofactor DGCR8, el transportador EXP5, el cofactor TRBP2 y argonauta ( AGO) [142]. Durante el procesamiento de miARN, estas proteínas están reguladas y su desregulación puede conducir a una expresión anormal de miARN. Este artículo se centra en estudios sobre la regulación del procesamiento de miARN que están involucrados en la resistencia a los medicamentos.

    Kovalchuk y col. [143], por primera vez, mostró que las células MCF-7 resistentes a DOX (MCF-7 / DOX) exhibían una desregulación considerable de su perfil de miARNoma y una expresión alterada de las enzimas de procesamiento de miARN Dicer y AGO 2. Estos miARN desregulados incluyen los implicados en la regulación de la quimiorresistencia celular, como el miRNA-451, que se dirige a la MDR1 gene. La transfección de células resistentes a MCF-7 / DOX con microARN-451 dio como resultado una mayor sensibilidad de las células a DOX, lo que indica que la corrección de la expresión alterada de miARN puede tener implicaciones significativas para las estrategias terapéuticas que tienen como objetivo superar la resistencia de las células cancerosas. Bu y col. [144] demostró directamente la relación entre Dicer y la resistencia celular a los fármacos de una manera diferente. Descubrieron que en la línea celular de cáncer de mama MCF-7, la eliminación de Dicer por ARNip condujo a una detención significativa de G1 y una mayor sensibilidad al CDDP. Además, la disminución de la expresión de miARN-21 acompañó a la disminución de Dicer. Otro estudio mostró que el hialuronano podría mediar en la fosforilación del marcador de células madre, Nanog, en la línea celular de tumor de mama MCF-7. Nanog fosforilado luego incrementó la ARNasa III Drosha y la ARN helicasa p68. Este proceso condujo a la producción de microARN-21 y a la reducción de proteínas supresoras de tumores (por ejemplo, PDCD4). Todos estos eventos contribuyeron a la regulación positiva de los inhibidores de las proteínas de la apoptosis (IAP) y MDR1, lo que resultó en resistencia a la antiapoptosis y la quimioterapia [145]. Kim y col. [146] demostró que el inhibidor 1 de ribonucleasa / angiogenina (RNH1) era necesario para el procesamiento de pri-miR-21. Un análisis adicional mostró que RNH1 interactuaba directamente con el complejo Drosha y PTEN bloqueaba esta interacción, disminuyendo la expresión de miARN-21. Es decir, la regulación de la expresión de miARN-21 mediada por PTEN se logró inhibiendo la interacción entre RNH1 y Drosha.

    Los pri-miARN son escindidos por un microprocesador, que comprende la enzima RNasa III bicatenaria Drosha y su cofactor esencial, DGCR8, para producir pre-miARN [142]. MiRNA-15a / 16 participó en la regulación de la quimiorresistencia en células tumorales (Tabla 1), y su expresión se correlacionó directamente con la expresión de nucleolina. La localización celular fue fundamental para el correcto funcionamiento de la nucleolina en esta vía. La nucleolina interactúa directamente con DGCR8 y Drosha en el núcleo, regulando así la expresión de miARN-15a / 16 [147]. Curiosamente, las proteínas involucradas en el procesamiento de miARN, como Dicer, también están reguladas por miARN. Se ha demostrado que la escisión imprecisa de un ARN primario o precursor por Drosha o Dicer, respectivamente, puede producir un grupo de variantes de miARN designadas como "isomiR". Existen diferentes mecanismos de regulación del miARN-31 en diferentes células (Tabla 1) y en su biogénesis, pudiendo producirse el procesamiento de tres isoformas (miR-31-H, miR-31-P y miR-31-M), que difieren sólo ligeramente en sus secuencias de los extremos 5 'y / o 3'. Chan y col. [148] validó un gen objetivo predicho, Jugador, para ser un objetivo novedoso de miR-31, pero solo miR-31-P podría reprimir directamente Jugador expresión tanto en las células de cáncer de mama MCF-7 como en las células de cáncer de pulmón A549, lo que da como resultado una mayor sensibilidad a CDDP, un atributo conocido de Dicer knockdown. Esto muestra que existe una relación compleja entre el miARN y sus proteínas de procesamiento.

    CeRNA

    El concepto de ceRNA fue presentado por primera vez por Salmena et al. en 2011 [149]. La hipótesis sugirió que además del ARNm, las secuencias de pseudogenes, los ácidos ribonucleicos largos no codificantes (lncRNA) y los ARN circulares (circRNA) contienen elementos de respuesta de miARN (MRE), y competirían por grupos limitados de miARN como señuelos, similares a " esponjas de miARN ”, reduciendo así la unión del miARN a su gen diana“ legítimo ”. La hipótesis del ARNc postulaba que cualquier transcripción de ARN que albergue MRE puede secuestrar miARN de otras dianas que comparten los mismos MRE, regulando así su función [150]. En la actualidad, algunos estudios han indicado que los ARNc pueden afectar el efecto regulador de los miARN relacionados con la quimiorresistencia en sus genes diana [151, 152].

    PTEN es un gen supresor de tumores y su expresión está regulada a la baja en una variedad de tumores. El 3′-UTR de PTEN El ARNm puede ser dirigido por una variedad de miARN, inhibiendo así su expresión. PTENP1 es un pseudogen del PTEN gen de supresión tumoralTSG), y su secuencia de ARNm, cercana a la 3′-UTR, es altamente homóloga a la misma región en PTEN. Esta característica de PTENP1 muestra que se puede utilizar como un ceRNA de PTEN. De hecho, el 3′-UTR de PTENP1 y PTEN Ambos mRNA albergan MRE que pueden unirse al miRNA-21. Yu y col. [152] encontró que la sobreexpresión de miARN-21 en el carcinoma de células renales de células claras (ccRCC) podría promover la proliferación celular, la migración y la invasión in vitro, y el crecimiento de tumores y metástasis in vivo. Sobreexpresión de PTENP1 en células que expresan miARN-21 reduce la proliferación celular, invasión, crecimiento tumoral y metástasis, recapitulando los fenotipos inducidos por PTEN expresión. Además, la sobreexpresión de PTENP1 en células ccRCC sensibilizó estas células a tratamientos con CDDP y GEM, in vitro e in vivo. En muestras clínicas, las expresiones de PTENP1 y PTEN se correlacionaron inversamente con la expresión de miARN-21. Pacientes con CcRCC sin PTENP1 expresión tienen una tasa de supervivencia más baja. Estos resultados sugirieron que PTENP1 funciona como un ceRNA en ccRCC, que suprime la progresión del cáncer.

    En resumen, ceRNA es un concepto relativamente nuevo. Aunque existen algunos estudios sobre la relación entre los ceRNA y la tumorigénesis [153, 154], los informes sobre los ceRNA asociados con la regulación de la quimiorresistencia son raros. Se cree que en el futuro se descubrirán más ceRNA relacionados con la quimiorresistencia.


    3 RESULTADOS

    3.1 Conjuntos de datos incluidos y evaluación de la calidad

    Como se muestra en el diagrama de flujo (Figura S1), recuperamos conjuntos de datos de las bases de datos GEO, Array Express, SRA, Oncomine, TCGA y GTEx. Se obtuvo un total de 109 conjuntos de datos después de eliminar 48 duplicados. Entre estos conjuntos de datos, se excluyeron 26, cuyos datos no estaban disponibles. Después de verificar las matrices, se eliminaron siete conjuntos de datos sin MAOA datos de expresión. Finalmente, se incluyeron 76 conjuntos de datos para el análisis. Para solidificar la confiabilidad de nuestro estudio, los datos fueron verificados por LJD, GL e YX de forma independiente, y se llegó a un consenso.

    3.2 Información del conjunto de datos

    La Tabla S1 muestra la información básica de los 76 conjuntos de datos incluidos y un microarray de tejido interno, que cubre 4348 pacientes con HCC y 3624 controles no cancerosos de 2007 a 2020. Los conjuntos de datos provienen de diversas etnias: 42 conjuntos de datos asiáticos y 34 conjuntos de datos no asiáticos . Los niveles de expresión de MAOA en los pacientes con CHC y los grupos de control se analizaron mediante tecnología genechip (N = 58) o el método de secuenciación de ARN (N = 18). Los niveles de expresión de MAOA en los pacientes con CHC y los grupos sin cáncer se compararon utilizando los niveles de expresión medios (M) y la desviación estándar (DE). Todas las muestras fueron tejidos hepáticos recolectados de pacientes con HCC y de individuos sin cáncer.

    3.3 Disminución del nivel de expresión de ARNm de MAOA en pacientes con CHC

    Los estados de expresión de MAOA en varios cánceres se muestran en la Figura S2A. Entre los conjuntos de datos de secuenciación de ARN, siete conjuntos de datos mostraron una tendencia significativa de regulación a la baja de MAOA en los pacientes con HCC en comparación con los grupos sin cáncer: GSE63018, GSE56545, GSE63863, GSE77509, GSE77314, TCGA-GTEx y GSE69164 (todos con PAG-valores & lt.05 Figura S2B-Q). En cuanto a los conjuntos de datos de genechip, los diagramas de dispersión en la Figura S3A-P muestran niveles de expresión significativamente más bajos de MAOA en los pacientes con HCC en comparación con los grupos sin cáncer en GSE6764, GSE14323, GSE14520-GPL571, GSE14520-GPL3921, GSE29721, GSE45436, GSE55092, GSE76297, GSE102079, GSE112790, GSE121248, GSE5594236, y GSE PAG-valores & lt.05).Posteriormente, se realizó la prueba de heterogeneidad de los conjuntos de datos incluidos, y un resultado de I 2 = 84.9% (PAG-valor & lt .0001) indicó una heterogeneidad significativa. Por lo tanto, se utilizó un análisis de efectos aleatorios para calcular la DME. El resultado exhibido en el MAOA Los niveles de expresión en pacientes con HCC fueron significativamente más bajos que en los grupos sin cáncer (Figura 1, DME = −0,32, IC del 95%: −0,45 a −0,18). Además, el resultado del análisis sensible no mostró diferencias significativas entre los estudios incluidos (Figura S4A). El gráfico de embudo de Begg no indicó sesgo de publicación, con un PAG-valor = .657 (Figura S4B). Se realizaron dos análisis de subgrupos para evaluar el estado de expresión de MAOA desde dos perspectivas (Figuras S5 y S6). Los resultados revelaron que ni la etnia ni los métodos utilizados para determinar la MAOA Los niveles de expresión de ARNm de pacientes con HCC fue la fuente de heterogeneidad en el presente estudio, ya que MAOA fue regulado a la baja en todos los subgrupos. Para validar el MAOA estado de expresión en HCC, también descargamos los datos de secuenciación de ARN de la Enciclopedia de la línea celular del cáncer del Instituto Broad (CCLE). Sorprendentemente, encontramos que MAOA no se expresó en las líneas celulares de C3A_LIVER, ALEXANDERCELLS_LIVER y HLE_LIVER. Por lo tanto, la evidencia confirmó la regulación a la baja. MAOA nivel en HCC.

    3.4 Valor diagnóstico y pronóstico prometedor de la regulación a la baja MAOA en HCC

    Las curvas ROC de los siguientes seis conjuntos de datos de secuenciación de ARN indicaron la capacidad discriminatoria de MAOA en los grupos de pacientes con HCC y sin HCC: GSE63018, GSE56545, GSE63863, GSE77509, GSE77314 y GSE69164 (todos con AUC & gt0.70 y PAG-valores & lt.05 Figura S7A-P). Con respecto al conjunto de datos del chip genético, la notable capacidad de distinción de MAOA en los pacientes con HCC y en individuos sin cáncer se exhibió en GSE14520-GPL571, GSE14520-GPL3921, GSE29721, GSE45436, GSE112790 y GSE59259 (todos con AUC & gt0.70 y PAG-valores & lt.05 Figura S8A-I). El AUC de la curva sROC, la sensibilidad y la especificidad fueron 0,77 (IC del 95%: 0,73-0,80), 0,56 (IC del 95%: 0,51-0,61) y 0,85 (IC del 95%: 0,81-0,88), respectivamente (Figura 2A ). En el gráfico de Fagan, con una probabilidad previa a la prueba del 20%, la probabilidad posterior a la prueba de HCC utilizando MAOA para un resultado positivo de la prueba fue del 48%, y la probabilidad de un resultado negativo de la prueba fue del 11%, lo que sugiere que MAOA podría servir como un marcador notable para la detección de CHC (Figura 2B). El cociente de probabilidad de diagnóstico positivo (DLR P), el cociente de probabilidad de diagnóstico negativo (DLR N), la puntuación de diagnóstico y el cociente de probabilidades de diagnóstico fueron 3,74 (IC del 95%: 3,01-4,64), 0,51 (IC del 95%: 0,46-0,57), 1,98 (IC del 95%: 1,73-2,23) y 7,26 (IC del 95%: 5,64-9,34) respectivamente (Figura 2C y D) .Los resultados antes mencionados indicaron que MAOA tenía una excelente capacidad discriminatoria para el HCC. Además, el nivel de expresión regulado a la baja de MAOA fue relevante para la edad (≥ 60), la raza (asiática), el estado de metástasis tumoral (M0), el grado histológico de la neoplasia (G1 & gtG2 & gtG3 & gtG4) y la concentración de AFP (& gt20 ng / mL) (todos con PAG-valores & lt0.05 Tabla S2 Figura S9A-E). Curiosamente, la curva de Kaplan-Meier indicó que el alto MAOA El grupo de expresión de ARNm tuvo un mejor resultado de supervivencia, con un cociente de riesgo de 0,61 (IC del 95%: 0,41-0,93) (Logrank PAG = .019 Figura 3), lo que indica que la regulación a la baja MAOAEl ARNm se correlacionó con un mal pronóstico de los pacientes con CHC.

    3.5 Alteraciones genéticas y tipos de mutación de MAOA en HCC

    MAOA se alteró en 30 (8%) de los 440 pacientes en el estudio sobre carcinoma hepatocelular de hígado (TCGA, Provisional) (Figura 4A). En particular, no se dispuso de toda la información sobre alteraciones genéticas de los pacientes. Las alteraciones genéticas de MAOA en HCC se centraron en la mutación sin sentido, la amplificación, la deleción profunda y el nivel de sobreexpresión de ARNm. Más estudios sobre el tipo de mutación de MAOA en HCC mostró que el sentido erróneo era el tipo de mutación predominante (Tabla S3).

    3.6 Identificación de CEG de MAOA y DEG

    El coeficiente de correlación de Pearson de MAOA y se computaron otros genes en cada conjunto de datos. Se trazaron dos mapas de calor de correlación basados ​​en los coeficientes de correlación de Pearson calculados de GSE6222 y GSE19665 (Figura S10A y B). Posteriormente, los genes coexpresados ​​que cumplen los estándares del valor absoluto del coeficiente de correlación de Pearson & gt0.3 y un PAG-valor & lt.05 se obtuvieron para análisis adicionales. Un total de 5099 MAOA CEG relacionados positivamente y 1565 MAOA Se identificaron CEG relacionados negativamente, todos los cuales aparecieron en no menos de nueve conjuntos de datos. Aquí en, PCOLCE y TBC1D8 se detectaron como los CEG más significativos relacionados positivamente con MAOA, y PKM se detectó que eran los CEG más significativos relacionados positivamente con MAOA (Figura S11A y B). Además, se identificaron 2267 genes regulados negativamente y 1478 genes regulados positivamente que aparecen en no menos de ocho conjuntos de datos. En total, 597 genes de intersección del MAOA CEG relacionados positivamente y DEG regulados negativamente y 184 genes de intersección del MAOA Se obtuvieron CEG relacionados negativamente y DEG regulados positivamente (Figura 4B y C).

    3.7 Análisis de enriquecimiento GO, DO y KEGG y construcción de redes PPI

    De acuerdo con los 597 genes de intersección del MAOA CEG positivamente relacionados y DEG regulados negativamente, el análisis de GO mostró la importancia del proceso catabólico de ácidos orgánicos, micropartículas sanguíneas y actividad monooxigenasa en términos de proceso biológico (BP), componente celular (CC) y función molecular (MF) respectivamente (Figura 5A Tabla S4). Para los 184 genes de intersección del MAOA Los CEG relacionados negativamente y los DEG regulados positivamente, la activación de células T, el complejo proteico del MHC de clase II y la actividad del receptor del MHC de clase II se enfatizaron en términos de BP, CC y MF, respectivamente (Figura 5B, Tabla S5). Según los 597 genes de intersección, el análisis de DO y el análisis de enriquecimiento de KEGG indicaron que la enfermedad de las arterias coronarias (Figura 6A) era la enfermedad predominantemente asociada y que el metabolismo del retinol y la carcinogénesis química eran las dos principales vías agrupadas (Figura 6B). Queríamos centrarnos en la vía de la carcinogénesis química. Por lo tanto, analizamos el proceso específico de la vía de la carcinogénesis química (Figura S12) y encontramos que MAOA podría participar en la patogénesis y progresión del HCC y otros cánceres a través de múltiples genes, a saber, CYP1A1, CYP1A2, CYP2A, CYP2E1, CYP3A4, GST, HSD11B1, NAT, NAT2 y UGT. Entre estos genes, CYP3A4 jugó un papel importante en el proceso de carcinogénesis del HCC al promover la transformación de aflatoxina B1 en AFB1-exo-8,9-epóxido. Los 184 genes de intersección del MAOA Los CEG relacionados negativamente y los DEG regulados positivamente se relacionaron significativamente con la coriomeningitis linfocítica (Figura 6C) y se enriquecieron principalmente en la vía KEGG de la artritis reumatoide (Figura 6D). Además, las redes de PPI se construyeron basándose en los genes de la vía de la carcinogénesis química para mostrar la interacción de las proteínas (Figura S13). CYP2E1 fue seleccionado como el gen concentrador en la red. También exploramos el valor pronóstico de CYP2E1 y, de acuerdo con MAOA, los resultados que indican un CYP2E1 bajo se correlacionaron con la supervivencia global reducida en pacientes con HCC (Figura S14A y B).

    3.8 Nivel de expresión de proteínas e importancia clínica de MAOA en HCC

    Los resultados de las micromatrices de tejido y la tinción IHC indicaron que el nivel de expresión de la proteína MAOA disminuyó significativamente en HCC en comparación con las muestras sin HCC (Figura 7A), de acuerdo con el estado de expresión de MAOA desde el nivel de ARNm. Se trazó una curva de Kaplan-Meier de los pacientes con carcinoma hepatocelular basada en el nivel de expresión de la proteína MAOA, y no se identificó una diferencia significativa entre los grupos de expresión de la proteína MAOA baja y alta en pacientes con HCC (Figura 7B). Las imágenes de tinción inmunohistoquímica IHC de HCC (Figura 7C, E y G) y no HCC (Figura 7D, F y H) bajo un microscopio (× 400) indicaron una expresión de proteína MAOA más baja en HCC en comparación con tejidos sin HCC, según lo confirmado por los resultados de tinción IHC de Human Protein Atlas

    (Figura 7G y H). Más importante aún, encontramos que una menor expresión de la proteína MAOA se correlacionó significativamente con el estadio TNM avanzado de los pacientes con HCC (Tabla S6).

    3.9 Efecto de NC en el MAOA expresión en el modelo HCC de ratón desnudo

    Los volúmenes tumorales de los ratones desnudos tratados con NC se redujeron significativamente en comparación con los ratones desnudos de control (PAG-valor & lt.05). 39 Un total de dos tejidos de CHC tratados con NC y tres de control fueron elegibles para el análisis de expresión. Los perfiles de expresión de ARNm en tejidos de HCC disecados de ratones desnudos tratados con NC y de control se determinaron mediante secuenciación de próxima generación. Se identificaron los DEG y se trazó un diagrama de volcán (Figura S15). Como era de esperar, el MAOA El nivel de expresión fue significativamente elevado en el grupo tratado con NC en comparación con el grupo de control.


    Supervivencia de las células cancerosas en el microambiente óseo

    Osteomimetismo

    Se ha sugerido que las células cancerosas hacen metástasis preferentemente en los huesos debido a su capacidad para expresar genes que normalmente se consideran huesos o relacionados con los huesos [36]. Al hacerlo, las células cancerosas están equipadas para albergar, adherirse, sobrevivir y proliferar en el microambiente óseo. Los factores osteomiméticos incluyen osteopontina (OPN), osteocalcina, osteonectina, sialoproteína ósea, RANKL y PTHrP. Varias de estas moléculas están relacionadas con el reclutamiento y la diferenciación de los osteoclastos, algunas de las cuales son actores prominentes en el círculo vicioso. Por ejemplo, la OPN es producida por muchas células de cáncer de mama y tiene una fuerte correlación clínica con un mal pronóstico y una disminución de la supervivencia [37]. Puede contribuir a la supervivencia, proliferación, adhesión y migración de las células tumorales. En el hueso, la OPN participa en la diferenciación y actividad de los osteoclastos y en la inhibición del depósito de minerales en el osteoide [37]. Los resultados de un en vivo El estudio mostró que los ratones con deficiencia de OPN mostraron una reducción significativa de la metástasis ósea [38].

    Expresión runx2

    Curiosamente, muchos factores osteomiméticos están regulados por el mismo factor de transcripción, Runx2, considerado el principal regulador del compromiso y la diferenciación de los osteoblastos [39]. Se requiere para que las células mesenquimales se conviertan en osteoblastos. Runx2 disfuncional da como resultado la detención del desarrollo de los osteoblastos y la inhibición de la osteogénesis. Runx2 regula a la baja la proliferación e induce la expresión de p21, RANKL, MMP2, MMP9, MMP13, VEGF, OPN, sialoproteína ósea y proteína PTHrP para promover la diferenciación de osteoblastos, el desarrollo y el recambio óseo [39].

    También se ha sugerido que Runx2 se expresa ectópicamente en células de cáncer de mama metastásico destinadas al hueso. La evidencia de un modelo de metástasis ósea intratibial indica que cuando las células MDA-MB-231 metastásicas altamente agresivas expresan Runx2 disfuncional o ARN pequeño en horquilla para Runx2, tanto la osteoclastogénesis como las lesiones osteolíticas disminuyen [40]. Estos resultados significan un papel importante para Runx2 derivada de células cancerosas en el proceso osteolítico. Investigaciones recientes han revelado cómo la célula cancerosa Runx2 afecta a otras células en el microambiente óseo y promueve la osteólisis. Pratap et al [40] encontraron que Runx2 responde a la estimulación de TGF-β activando la expresión del erizo indio (IHH), que aumenta aún más el nivel de PTHrP. Por lo tanto, Runx2 juega un papel importante en el círculo vicioso a través de las vías de IHH-PTHrP inducidas por TGF-β en las células de cáncer de mama, lo que da como resultado un aumento de la osteoclastogénesis y la osteólisis.


    Resultados

    La expresión del gen TAP1 en diferentes tipos de cáncer.

    Para analizar la expresión de ARNm del gen TAP1 en diferentes tipos de cáncer, utilizamos tres bases de datos. Usamos ONCOMINE para analizar la comparación de la expresión de ARNm de TAP1 para diferentes tipos de cáncer y sus tejidos normales. Se informó que el análisis único total fue 453, entre los 453 análisis 42 fueron significativos (Fig. 1A). La comparación en ONCOMINE se realizó a través de Student t prueba, una pag-valor de 0,0001, y un doble de cambio de 2. Los niveles de ARNm se sobreexpresaron en los cánceres de vejiga, cerebro y sistema nervioso central (SNC), mama, cuello uterino, cabeza y cuello, riñón, hígado, linfoma, ovario y páncreas mientras sub-expresado sólo en el cáncer de pulmón, a diferencia de los tejidos sanos. A continuación, se utilizó el servidor GEPIA2 para estudiar el perfil de los niveles de expresión de TAP1 en múltiples tipos de cáncer mediante pruebas ANOVA con un valor p ajustado de 0,05 (Fig. 1B). Los datos se extrajeron de TCGA, donde indagamos en 33 tipos de tumores emparejados con sus muestras normales para la expresión de ARNm de TAP1. Vimos que, entre otros tipos de cáncer, BRCA (cáncer de mama), LIHC (carcinoma hepatocelular de hígado), LUAD (adenocarcinoma de pulmón) y OV (cáncer de ovario) se sobreexpresaron significativamente. También analizamos la expresión de TAP1 para diferentes tejidos tumorales y sus respectivas contrapartes utilizando GENT2 a través de la base de datos HG-U133Plus2, y consideramos la prueba t de dos muestras pag-valor de & lt 0,001 (Fig. 1C). El diagrama de caja mostró una expresión de TAP1 en todo el tejido entre los experimentos de cáncer. La expresión de ARNm fue significativamente mayor para mama, hígado, pulmón y ovario en comparación con los tejidos normales.

    Expresión de TAP1 en diferentes tipos de cáncer: (A) cáncer frente a regulación al alza normal (rojo) y regulación a la baja (azul) en las columnas izquierda y derecha, respectivamente, con parámetros predeterminados de un pag-valor: 1E-4, cambio de veces: 2 y un% de clasificación de genes: 10% para la expresión de ARNm en la base de datos ONCOMINE. (B) Los perfiles de transcripción de ARNm para TAP1 en varios tipos de cáncer fueron detectados por la base de datos TCGA a través del sitio web GEPIA2 (Gene expression Profiling Interactive Analysis 2). En el gráfico de puntos, el gráfico rojo representa un tumor y el gráfico azul representa tejidos normales. Cada punto representaba la expresión de muestras. Las muestras de tumor se compararon con sus contrapartes para observar los criterios de expresión. (C) El perfil de expresión de TAP1 en diferentes cánceres y sus contrapartes se detectó a través de la expresión génica en tejido normal y tumoral (GENT2) con diagrama de caja, donde las cajas con color rojo indican células cancerosas, las cajas con color azul indican células normales, la línea media muestra la mediana y los puntos son los valores atípicos

    El patrón de expresión de TAP1 en cáncer de mama, pulmón, hígado y ovario

    Además, investigamos el patrón de expresión del gen TAP1 en varios tipos de cáncer (Fig. 2). Usamos la base de datos ONCOMINE para observar la expresión génica y los cambios de pliegue. Se procedió a considerar cuatro tipos de cáncer: cáncer de mama, pulmón, hígado y ovario. Se observó que la expresión estaba regulada al alza en los cánceres de mama, hígado, ovario y pulmón (fig. 2A-2D). La herramienta GEPIA2 se utilizó para investigar la expresión del gen TAP1 (Fig. 2E-2H), donde los niveles de expresión de los cánceres LIHC y OV eran significativamente más altos que los de los tejidos normales. La expresión en el tumor primario y el normal se comparó utilizando la base de datos TCGA en la herramienta UALCAN (Fig. 2I – 2K). Se observó una sobreexpresión significativa de la expresión de TAP1 en el tumor primario en comparación con el normal en BRCA, LIHC y LUAD.

    Se observó una comparación de cáncer frente a normal en varios cánceres para el patrón de expresión de TAP1. El análisis de diagrama de caja para los cambios en el pliegue de TAP1 (transformación log2 del cambio de expresión génica) se realizó utilizando cuatro cánceres a saber: cáncer de mama, hígado, pulmón y ovario donde el diagrama de la izquierda representa normal y el diagrama de la derecha representa células tumorales, y el más alto y los niveles más bajos se muestran con un asterisco (A – D) utilizando la herramienta analítica ONCOMINE. (A) carcinoma ductal invasivo de mama, (B) carcinoma hepatocelular, (C) carcinoma papilar de superficie serosa de ovario, (D) carcinoma de células escamosas de lengua, carcinoma de pulmón de células escamosas. (E – H) La investigación del patrón de expresión analítica de TAP1 fue realizada por GEPIA2 utilizando el método diferencial ANOVA. *pag-valor: 0.01. (I – K) fueron utilizados por UALCAN web y las muestras de TCGA se utilizaron para analizar la expresión de TAP1 en células tumorales primarias frente a células normales

    El patrón de expresión de la proteína TAP1 en cáncer de mama, pulmón, hígado y ovario

    Exploramos la expresión de la proteína TAP1 derivada de la elaboración de perfiles de proteínas basada en anticuerpos utilizando inmunoquímica para los diferentes tejidos cancerosos y sus tejidos normales homólogos (Fig. 3). Los niveles de proteína de TAP1 fueron altos en todos los tejidos de tipo canceroso, con tinción alta y fuerte intensidad (Fig. 3A (ii), 3B (ii), 3C (ii) y 3D (ii)). Sin embargo, también encontramos altos niveles de proteína en los tejidos granulares de mama e hígado (Fig. 3 A (i) y C (i)).

    Expresión de la proteína TAP1 en (A) tejido de carcinoma del conducto mamario en comparación con tejido mamario normal. (B) Tejido de adenocarcinoma de pulmón comparado con tejido pulmonar normal. (C) Tejido de colangiocarcinoma hepático a tejido hepático normal. (D) Tejido de cistadenocarcinoma de ovario comparado con tejido de ovario normal que describe su inmunoquímica utilizando la base de datos de Atlas de proteínas humanas

    Análisis de expresión del gen TAP1 con características clínicas

    Analizamos la expresión del gen TAP1 con diferentes características clínicas utilizando la base de datos en línea UALCAN. La expresión del gen TAP1 en tejido normal se comparó con tejidos en pacientes con diferentes resultados clínicos para cánceres de mama, hígado, pulmón y ovario (Fig. 4 y Tabla complementaria 1). La sobreexpresión del gen TAP1 en pacientes con cáncer en comparación con el tejido normal fue mayor en la etapa 2 para LUAD (pag = 3.37e-09) y LIHC (pag = 2.97e-08) cáncer, estadio 2 (pag = 1,62e-12) y etapa 4 (pag = 1.08e-03) estuvieron entre los más altos para BRCA. La etapa 3 (p & lt 1e-12) tuvo el menor nivel de expresión para TAP1 en BRCA, y la etapa 4 (pag = 5.96e-03) mostró el nivel más bajo de expresión para LIHC y etapa 1 (pag = 1.04e-10) y etapa 4 (pag = 1.33e-02) estuvieron entre los más bajos para LUAD (Fig. 4A, B, D). No hubo expresión significativa de TAP1 en cáncer de ovario. Todas las etapas, para BRCA, LIHC y LUAD, en comparación con los tejidos normales, tenían una expresión de ARNm significativamente elevada. Se observó una sobreexpresión estadísticamente significativa del gen TAP1 en pacientes con cáncer de diferente etnia en comparación con tejidos normales en BRCA, LIHC y LUAD (Fig. 4E, F, H). Los niveles de expresión del gen TAP1 fueron significativamente más altos en las mujeres que tenían cáncer de mama que en las contrapartes normales (Fig.4I, pag = 1,62e-12). La expresión de TAP1 tuvo una diferencia significativa tanto para mujeres frente a normales como para hombres frente a normales, para LIHC y LUAD (Fig. 4J, K).

    La relación de la expresión de TAP1 con diferentes características clínicas en personas afectadas de cáncer se mostró en un diagrama de caja donde se detectó el nivel de expresión de ARNm de TAP1 a través de la web UALCAN. (A – D) Análisis de expresión de los atributos del paciente según las etapas específicas del cáncer para BRCA, LIHC, OV y LUAD, respectivamente. (E – H) La expresión de la raza del paciente para BRCA, LIHC, OV y LUAD, y basada en el género de un paciente (I – K) para BRCA, LIHC y LUAD, respectivamente. Significación estadística evaluada por el estudiante t prueba (varianza desigual). *pag & lt 0.05

    Metilación del promotor del gen TAP1 con características clínicas

    Analizamos el nivel de metilación del promotor del gen TAP1 con diferentes características clínicas utilizando la base de datos en línea UALCAN. Se utilizaron sondas CpG para identificar una correlación entre los niveles de expresión y la metilación del promotor. Los diagramas de caja mostraron un valor beta promedio de metilación del ADN en muestras de TCGA. La metilación del promotor del gen TAP1 en tejido normal se comparó con tejidos en pacientes con diferentes resultados clínicos para cáncer de mama, hígado, pulmón y ovario (Fig. 5 y Tabla complementaria 2). La metilación del promotor aumentó significativamente en muestras de tumores que en tejidos normales para BRCA (pag= 4,00e-03), LIHC (pag = 2.36e-02) y LUAD (pag = 5,99e-03) (Fig. 5A – C). En comparación con el tejido normal, los pacientes con estadio 1 (pag = 3.25e-02) y etapa 2 (pag = 4.17e-04) BRCA mostró una regulación al alza significativa en el valor beta (Fig.5D), los pacientes con LIHC tuvieron la metilación del promotor más alta en la etapa 1 (pag = 2,32e-02) (Fig. 5E), los pacientes que tenían LUAD en estadio 1 y 3 tenían una elevación significativa en la metilación del promotor que el tejido normal (Fig. 5F). En comparación con el tejido normal, los pacientes asiáticos y afroamericanos tenían un aumento de la metilación del promotor en BRCA, y los pacientes caucásicos tenían un aumento de la metilación para LIHC y LUAD (Fig. 5G-I). En el cáncer de mama, hígado y pulmón, la metilación del promotor TAP1 se mantuvo significativamente sin cambios para las mujeres en comparación con el tejido normal (Fig. 5J-L). Sin embargo, el análisis no sugiere una relación específica entre la metilación del ADN de TAP1 y los subtipos clínico-patológicos.

    La relación de la metilación del promotor de TAP1 con diferentes características clínicas en personas afectadas de cáncer se mostró en un diagrama de caja donde se detectó el nivel de metilación del promotor de ARNm de TAP1 a través de la web UALCAN. (A – C) El nivel de metilación del tumor primario y en las contrapartes en BRCA, LIHC y LUAD, respectivamente. (D – F) Nivel de metilación del promotor para las características del paciente según las etapas específicas del cáncer para BRCA, LIHC y LUAD, respectivamente. (G – I) Nivel de metilación del promotor para la raza del paciente para BRCA, LIHC y LUAD y basado en el sexo del paciente (J – L) para BRCA, LIHC y LUAD, respectivamente. Rango de metilación del ADN: 0-1, 0, 0.5 y 1 respectivamente corresponden a sin metilar, hemi-metilado (50% de metilación) y completamente metilado. Se tomaron en cuenta varios puntos de corte que van de 0,7 a 0,5 que muestran hipermetilación, 0,3 a 0,25 que muestran hipometilación.

    Nota: No hubo datos disponibles para OV en UALCAN para la metilación del promotor.

    ARNm mutante, mutaciones genéticas y alteraciones en el número de copias de TAP1

    Utilizando la base de datos cBioPortal, se estudió la alteración genética de TAP1 en diferentes cánceres. Base de datos generada consultada para observar la mutación genética de TAP1 en 7710 muestras de 12 casos de cánceres BRCA, LIHC, LUAD y OV. Del total de muestras consultadas, hubo una alteración del 2% en el conjunto de genes o en las vías con una frecuencia de mutación somática del 0,3%. Teniendo en cuenta los estudios de muestras múltiples, en total 21 mutaciones, incluidas 9 duplicaciones, se informaron para el área del gen TAP1 (Fig. 6A). Observamos entre 1 y 808 aminoácidos en el propéptido TAP1 y el dominio TAP1 para la consulta. En medio de esas mutaciones, 19 tenían un sentido erróneo y 2 mutaciones truncadas se identificaron a fondo. El adenocarcinoma de mama y el cáncer de pulmón tenían el nivel más alto de mutaciones que se encontraron en ellos, y las mutaciones se ubicaron entre un hotspot en R547C / H. Se identificaron dos mutaciones en el R547C / H. El sitio contenía mutaciones, como mutaciones sin sentido, que se descubrieron en 8 muestras de adenocarcinoma de mama, 3 de cáncer de pulmón expresaron mutaciones sin sentido. Para los conjuntos de datos de cáncer de ovario, la frecuencia de alteración se encontró más alta (& gt6%) entre los cuatro tipos de cáncer (Fig. 6B). En consecuencia, generó la expresión de ARNm de TAP1 (ARN Seq V2) entre 12 casos de cánceres utilizando el cBioPortal (Fig. 6C). El cáncer de mama, 8 (7 sin sentido y 1 truncado) casos, tuvo el nivel más alto de mutación en la expresión de ARNm y, posteriormente, el cáncer de hígado fue el siguiente en mutación con 4 afectados.

    Análisis de la expresión de ARNm mutante, mutaciones genéticas y alteraciones en el número de copias del gen tap1 para diferentes estudios de cáncer utilizando cBioPortal. (A) Se observaron 21 mutaciones en muestras entre 1 y 808 residuos de aminoácidos entre el propéptido y el dominio de la proteína TAP1. (B) Se presentó gráficamente la frecuencia de alteración que muestra mutaciones (verde), amplificación (rojo), deleción profunda (azul) y alteraciones múltiples (gris). Se graficaron conjuntos de datos con un mínimo de 100 casos. (C) Truncar mutación (azul profundo), una mutación sin sentido (verde), sin mutación (azul claro) y mutación no perfilada (blanco) en la expresión de TAP1 por el método RNA-Seq V2 para una muestra de 12 estudios

    Investigación pronóstica de la expresión de TAP1 en pacientes con cáncer

    Se consideraron diferentes categorías de cáncer para el pronóstico de la expresión de ARNm de TPA1 y resumimos los datos utilizando las bases de datos de pronóstico con un valor p de Cox de una significancia de (pag& lt0.05). Para analizar la interacción en cuanto a la expresión de TAP1 con la razón de supervivencia para pacientes con cáncer de mama, pulmón, hígado y ovario, se utilizó la base de datos PrognoScan donde los grupos de expresión alta y baja de TAP1 se definieron mediante la prueba de rango logarítmico. En caso de cáncer de mama, los conjuntos GSE9195 y GSE1456-GPL96 proporcionaron datos de que los pacientes con expresión disminuida del gen TAP1 (norte = 57 y norte = 139 respectivamente) tuvieron una supervivencia libre de recaída significativamente mayor en comparación con los que tenían una mayor expresión de TAP1 (norte = 20, para ambos) (Fig. 7A, 7B). Los resultados encontrados para el conjunto de datos de cáncer de pulmón tuvieron las mismas consecuencias que los resultados del cáncer de mama, para OS y RFS (Fig. 7C, 7D). Aquí, los conjuntos de datos de cáncer de pulmón GSE31210 y GSE31210 mostraron que la baja expresión (norte = 180, para ambos) de ARNm de TAP1 exhibió una SG significativamente más alta en comparación con el grupo de ARNm de TAP1 más alto expresado (n = 24, para ambos casos). Por otro lado, el análisis del conjunto de datos GSE26712 y GSE26712 de PrognoScan mostró una SG y DFS significativamente más bajas del cáncer de ovario, para la menor expresión de ARNm de TAP1 (norte = 111 y norte = 149, respectivamente) en contraste con los niveles más altos de contrapartes (norte= 74 y norte = 36, respectivamente) (Fig. 7E, 7F). En el grupo de expresión de TAP1 inferior (norte= 203 y norte= 228 respectivamente) en el plotter KM para cáncer de hígado se informó una alta tasa de supervivencia en caso de SG y SLR, respectivamente, en comparación con la mayor expresión de las contrapartes (norte = 161 y norte = 88, respectivamente) (Fig. 7G, 7H). Principalmente, los datos centrados en que indiferente a la única diferencia de cáncer de ovario en la expresión, la alta expresión de TAP1 está en una correlación positiva con la baja tasa de supervivencia en los cánceres de mama, pulmón e hígado.

    Análisis de la supervivencia del paciente sobre la expresión de TAP1 en diferentes cánceres. La probabilidad de que las personas afectadas sobrevivan con una expresión de TAP1 alta (rojo) y baja (azul). Las gráficas se analizaron en busca de cánceres: (A, B) supervivencia sin recaída en la mama, (C, D) supervivencia general y supervivencia sin recaída en el pulmón, (E, F) supervivencia general y supervivencia sin enfermedad en el ovario, y (G, H) la supervivencia general y la supervivencia libre de recaídas en el hígado se recuperaron de la base de datos PrognoScan, con cox pag-valor de 0,05. La probabilidad de supervivencia con una curva de expresión de TAP1 alta (roja) y baja (negra) con respecto al tiempo en el cáncer de hígado (G, H) se recuperó del trazador KM

    Análisis de ontologías de vías y genes de genes coexpresados ​​de TAP1

    Por último, descubrimos los genes que se correlacionaron positivamente con el gen TAP1 en el cáncer BRCA, LIHC, LUAD y OV mediante el uso de la plataforma de visualización y análisis genómico R2 (Tabla complementaria 3). Los genes correlacionados se utilizaron en Venn Draw para dibujar un diagrama de Venn que nos proporcionó los genes correlacionados comunes en BRCA (6058 genes), LIHC (3773 genes), LUAD (4012 genes) y cáncer de OV (2901 genes) (Fig.8 y Cuadro complementario 4).

    Diagrama de Venn de genes correlacionados positivamente con el gen TAP1 para BRCA, LUAD, LIHC y OV, recopilado de la herramienta web Draw Venn y la herramienta web R2 genomics

    Extrajimos los genes comunes correlacionados positivamente para realizar una investigación ontológica. Usamos el software Enrichr para comprender qué vías de señalización estaban influenciadas por los genes coexpresados ​​positivamente y el gen TAP1 en BRCA, LIHC, LUAD y OV. En el análisis de la vía de la base de datos de KEGG, vimos que la vía de TAP1 de la Enciclopedia de genes y genomas de Kyoto (KEGG) más correlacionada y el gen que está en correlación positiva con TAP1, se asociaron principalmente con la vía del receptor de citocina-citocina, la quimiocina vía de señalización, linaje de células hematopoyéticas, inmunodeficiencia primaria, artritis reumatoide, moléculas de adhesión celular, enfermedad de Chagas, vía de señalización del receptor toll, Salmonela infección e infección por virus de inmunodeficiencia humana-1. La ruta del receptor de citocinas-citocinas y la ruta de señalización de quimiocinas son las rutas más importantes en las que se puede influir (Fig. 9A). La base de datos Panther mostró una interacción más significativa con la inflamación mediada por las vías de señalización de quimiocinas y citocinas. También mostró vías como la activación de células T, vía de señalización FAS, regulación citoesquelética por Rho GTPasa, vía de señalización de apoptosis, enfermedad de Huntington, activación de células B, vía de señalización de integrina, ciclo celular y mapa de señalización SSKR ST (Fig. 9B). La herramienta Enrichr también realizó un análisis de ontología genética para explorar los diferentes procesos basados ​​en los genes coexpresados. La coexpresión en procesos biológicos fue más significativa para la vía de señalización mediada por quimiocinas (GO 0070098), la respuesta inflamatoria y la quimiotaxis de linfocitos (Fig. 9C). En las funciones moleculares, el complejo receptor de células T, el gránulo terciario y el componente integral de la membrana plasmática (Fig. 9D), y en el componente celular GO, la unión del receptor de quimiocinas y la actividad de las quimiocinas fueron influenciadas principalmente (Fig. 9E).

    El análisis de señalización de rutas y ontologías de genes con correlación positiva con el gen TAP1 en BRCA, LUAD, LIHC y OV se presentó gráficamente utilizando Enricher Web. (A) Enciclopedia de genes y genomas de Kyoto (KEGG) Vías humanas 2019, (B) Panther 2016, (C) Términos de enriquecimiento del proceso biológico de GO (2018) en análisis proteómico, (D) Términos de enriquecimiento de la función molecular de GO (2018) en análisis proteómico, y (E) Enriquecimiento del componente celular GO (2018) términos en análisis proteómico. Barras generadas, que representan la relación,% de composición de términos en datos proteómicos:% de composición de anotación genómica, se clasifican por pag-valor


    Resultados

    Características demográficas de la población de estudio

    En este estudio se evaluaron 30 pacientes con asbestosis, 23 pacientes con silicosis y 25 controles sanos (tabla 1). Ninguno de los participantes inscritos en el estudio era fumador actual. Los pacientes con silicosis y controles sanos eran significativamente más jóvenes que los pacientes con asbestosis (PAG & lt 0,01) sin embargo, no se observaron diferencias significativas en la edad entre los grupos de silicosis y de control sano. La PaO2 El nivel fue significativamente más bajo en el grupo de asbestosis que en los grupos de silicosis y control (PAG & lt 0,05). Las pruebas de función pulmonar indicaron que la ventilación restrictiva y / o el intercambio de gases alterado estaban presentes en el grupo de asbestosis, mientras que la función pulmonar normal o una limitación leve del flujo de aire y una DLCO levemente disminuida estaban presentes en el grupo de silicosis.

    Expresión de PD-1 en CD4 circulante + o CD8 + Las células T disminuyeron en pacientes con asbestosis o silicosis.

    La Figura 1 no muestra diferencias significativas en las fracciones de linfocitos T CD4 + o CD8 + circulantes entre los tres grupos (PAG & gt 0,05). Primero investigamos la expresión de PD-1 (CD279) en PB. Como se muestra en la Fig.2a, c, se detectó una expresión de PD-1 significativamente menor en las células T CD4 + en PB de los grupos de asbestosis (media de 7,753%) y silicosis (media de 6,676%) que en PB del grupo de control sano (media de 11,790%, PAG & lt 0,01). De manera similar, la expresión de PD-1 en las células T CD8 + en PB también disminuyó significativamente en los grupos de asbestosis (media 9,556%) y silicosis (media 9,132%) en comparación con el grupo de control sano (media 14,670%, PAG & lt 0,05) (Fig. 2b, d). Sin embargo, no se observó una diferencia significativa en la expresión de PD-1 entre los grupos de asbestosis y silicosis (Fig. 2c, d).

    Porcentajes de linfocitos T CD4 + o CD8 + entre linfocitos en PB. Los porcentajes de CD4 + (a) o CD8 + (B) Células T entre linfocitos en el PB de controles sanos y pacientes con asbestosis o silicosis

    Análisis de la expresión de PD-1 en linfocitos T CD4 + o T CD8 + en PB. Análisis de citometría de flujo representativo de la expresión de PD-1 en CD4 + (a) o CD8 + (B) Células T. Los porcentajes de PD-1 + CD4 + (C) o PD-1 + CD8 + (D) Células T en controles sanos y pacientes con asbestosis o silicosis (C, D)

    Expresión de PD-L1 en CD4 circulante + Las células T disminuyeron en pacientes con asbestosis o silicosis.

    Como se muestra en la Fig. 3, PD-L1 (CD274) se detectó principalmente en las células T CD4 + circulantes en lugar de en las células T CD8 + en los controles sanos. Sin embargo, la expresión de PD-L1 en las células T CD4 + circulantes disminuyó significativamente en los grupos de asbestosis (media 0,212%) y silicosis (media 0,310%) en comparación con el grupo de control sano (media 0,705%) (PAG & lt 0.05) (Fig. 3a, c). No se observó ninguna diferencia significativa en la expresión de PD-L1 en las células T CD8 + circulantes entre los tres grupos (Fig. 3b, d).

    Análisis de la expresión de PD-L1 en células T CD4 + o T CD8 + en PB. Análisis de citometría de flujo representativo de la expresión de PD-L1 en CD4 + (a) o CD8 + (B) Células T. Los porcentajes de PD-L1 + CD4 + (C) o PD-L1 + CD8 + (D) Células T en controles sanos y pacientes con asbestosis o silicosis (C, D)

    Disminución de la expresión de PD-L1 y PD-L2 en CD14 circulante + monocitos en pacientes con asbestosis o silicosis

    Además, detectamos la expresión de PD-L1 (CD274) y PD-L2 (CD273) en monocitos CD14 + en PB. Como se ilustra en la Fig.4a, c, los porcentajes de monocitos PD-L1 + CD14 + circulantes disminuyeron significativamente en los grupos de asbestosis (media 0,541%) y silicosis (media 0,544%) en comparación con el grupo de control sano (media de 1,203%, PAG & lt 0,01). De manera similar, se observaron porcentajes más bajos de monocitos PD-L2 + CD14 + circulantes en los grupos de asbestosis (media 0,541%) y silicosis (media 0,525%) que en los controles sanos (media 1,161%, PAG & lt 0.01) (Fig. 4b, d). No se observó una diferencia significativa en la expresión de PD-L en monocitos entre los grupos de asbestosis y silicosis (Fig. 4c, d).

    Análisis de la expresión de PD-L1 o PD-L2 en células CD14 + en PB. Análisis de citometría de flujo representativo de la expresión de PD-L1 (a) o PD-L2 (B) en células CD14 +. Los porcentajes de PD-L1 + CD14 + (C) o PD-L2 + CD14 + (D) células en controles sanos y pacientes con asbestosis o silicosis

    Estado de activación de células T en pacientes con asbestosis y silicosis

    También exploramos el estado de activación de las células T efectoras en pacientes con asbestosis y silicosis. Los porcentajes de linfocitos T CD28 + CD8 + circulantes fueron significativamente más bajos en pacientes con asbestosis y silicosis que en los controles sanos (PAG & lt 0.05) (Fig.5b), y los porcentajes de células T HLA-DR + CD8 + circulantes fueron significativamente más altos en ambos grupos que en los controles sanos (PAG & lt 0.05) (Fig. 5d). No se detectaron diferencias significativas en los porcentajes de linfocitos T CD28 + CD4 +, linfocitos T HLA-DR + CD4 + y linfocitos T CD69 + CD4 + entre los grupos de asbestosis y silicosis (PAG & gt 0.05, Fig. 5a, cye). El porcentaje de células T CD69 + CD8 + en PB aumentó significativamente en el grupo de asbestosis en comparación con el grupo de control sano (PAG & lt 0,05), y el porcentaje de células T CD69 + CD8 + tendió a ser mayor en el grupo de silicosis que en el grupo de control sano (Fig. 5f). Los porcentajes de linfocitos T CD38 + CD4 + y linfocitos T CD38 + CD8 + en PB no fueron diferentes entre los tres grupos (fig. 5g – h). En particular, el porcentaje de células T PD-1 + CD8 + se correlacionó positivamente con el porcentaje de células T CD28 + CD8 + en la asbestosis (r = 0,464, PAG = 0.019 Fig.6a) y grupos de silicosis (r = 0.510, PAG = 0.032 Fig. 6b).

    El estado de activación de las células T efectoras en PB. El porcentaje de CD28 + CD4 + (a) o CD28 + CD8 + (B) Células T entre los tres grupos el porcentaje de HLA-DR + CD4 + (C) o HLA-DR + CD8 + (D) Células T entre los tres grupos el porcentaje de CD38 + CD4 + (mi) o CD38 + CD8 + (F) Células T entre los tres grupos y el porcentaje de CD69 + CD4 + (gramo) o CD69 + CD8 + (h) Células T entre los tres grupos

    Correlaciones entre las fracciones de células T PD-1 + CD8 + con las fracciones de células T CD28 + CD8 +. La fracción de células T PD-1 + CD8 + se correlacionó positivamente con la fracción de células T CD28 + CD8 + en el PB de pacientes con asbestosis (r = 0,464, PAG = 0.019) (a) o silicosis (r = 0,510, PAG = 0.032) (B)

    La expresión de PD-1 regulada negativamente se correlacionó con el porcentaje de FVC predicho

    Se han utilizado parámetros funcionales pulmonares para predecir la gravedad de las enfermedades pulmonares fibróticas crónicas [13]. Aquí, evaluamos las correlaciones entre la expresión de PD-1 y los parámetros de función pulmonar y encontramos que las proporciones de células T PD-1 + CD4 + (r = 0.591, PAG = 0,008) y células T PD-1 + CD8 + (r = 0,507, PAG = 0,027) se correlacionaron positivamente con el porcentaje de CVF predicho en el grupo de asbestosis (Fig. 7a, b). Además, todos los pacientes con asbestosis se clasificaron en subgrupos de estadio I, estadio II y estadio III según los hallazgos de la TC.Aunque no se observaron diferencias significativas entre las tres etapas, la expresión media de PD-1 en células T CD4 + o células T CD8 + en pacientes con asbestosis en etapa III fue menor que en pacientes con enfermedad en etapa I y etapa II (archivo adicional 1 : Fig. S1). Además, investigamos las relaciones entre la expresión de PD-1 y otros parámetros de función pulmonar: PaO2 y el índice fisiológico compuesto (IPC). No identificamos ninguna correlación entre la expresión de PD-1 y el% predicho de DLCO, el% predicho de TLC, la PaO2, o CPI (Archivo adicional 2, 3: Figs. S2-S3).

    Correlaciones entre la expresión de PD-1 y el% de FVC predicho en pacientes con asbestosis. Fracciones de células T PD-1 + CD4 + (r = 0,591, PAG = 0.008) (a) y fracciones de células T PD-1 + CD8 + (r = 0,507, PAG = 0.027) (B) se correlacionó positivamente con la FVC predicha. FVC, capacidad vital forzada


    Referencias

    Berx G, Staes K, van Hengel J, Molemans F, Bussemakers MJ, van Bokhoven A, van Roy F: Clonación y caracterización del gen supresor de invasión humana E-cadherina (CDH1). Genómica. 1995, 26: 281-289. 10.1016 / 0888-7543 (95) 80212-5.

    Guilford P: Regulación a la baja de E-cadherina en el cáncer: ¿combustible en el fuego ?. Mol Med hoy. 1999, 5: 172-177. 10.1016 / S1357-4310 (99) 01461-6.

    Gumbiner BM: Adhesión celular: la base molecular de la arquitectura y morfogénesis de los tejidos. Celda. 1996, 84: 345-357.

    Barth AI, Nathke IS, Nelson WJ: Cadherinas, cateninas y proteína APC: interacción entre complejos citoesqueléticos y vías de señalización. Curr Opin Cell Biol. 1997, 9: 683-690. 10.1016 / S0955-0674 (97) 80122-6.

    Gallin WJ, Sorkin BC, Edelman GM, Cunningham BA: Análisis de secuencia de un clon de ADNc que codifica la molécula de adhesión de células hepáticas, L-CAM. Proc Natl Acad Sci USA. 1987, 84: 2808-2812.

    Ringwald M, Baribault H, Schmidt C, Kemler R: La estructura del gen que codifica la molécula de adhesión celular de ratón uvomorulina. Ácidos nucleicos Res. 1991, 19: 6533-6539.

    Mansouri A, Spurr N, Goodfellow PN, Kemler R: Clonación molecular y localización cromosómica del gen que codifica la molécula de adhesión celular humana ovomorulina. Diferenciación. 1998, 38: 67-71.

    Vleminckx K, Vakaet L, Mareel M, Fiers W, van Roy F: La manipulación genética de la expresión de E-cadherina por células tumorales epiteliales revela un papel supresor de invasión. Celda. 1991, 66: 107-119.

    Bussemakers MJG, van Bokhoven A, Völler M, Smit FP, Schalken JA: Los genes de las moléculas de adhesión celular dependientes del calcio P- y E-cadherina están dispuestos en tándem en el genoma humano. Biochem Biophys Res Commun. 1994, 203: 291-1294.

    Kaupmann K, Becker-Follmann J, Scherer G, Jockusch H, Starzinski-Powitz A: el gen de la molécula de adhesión celular M-cadherina se asigna al cromosoma 8 del ratón y al cromosoma humano 16q24.1-qter y está cerca de la E-cadherina ( uvomorulin) en ambas especies. Genómica. 1992, 14: 488-490.

    Humphries MJ, Newham P: La estructura de las moléculas de adhesión celular. Trends Cell Biol. 1998, 8: 78-83. 10.1016 / S0962-8924 (97) 01188-4.

    Rietmacher D, Brinkmann V, Birchmeier CA: la mutación dirigida en el gen de E-cadherina de ratón da como resultado un desarrollo de preimplantación defectuoso. Proc Natl Acad Sci USA. 1995, 92: 855-859.

    Yap AS, Niessen CM, Gumbiner BM: La región de yuxtamembrana de la cola citoplasmática de chaderina soporta agrupamiento lateral, refuerzo adhesivo e interacción con p120ctn. J Cell Biol. 1998, 141: 779-789. 10.1083 / jcb.141.3.779.

    Huber AH, Weis WI: La estructura del complejo beta-catenina / E-cadherina y la base molecular del reconocimiento de diversos ligandos por beta-catenina. Celda. 2001, 105: 391-402.

    Takeichi M: Cadherinas en el cáncer: implicaciones para la invasión y metástasis. Curr Opin Cell Biol. 1993, 5: 806-11.

    Xiang YY, Tanaka M, Suzuki M, Igarashi H, Kiyokawa E, Naito Y, Othaware Y, Shen Q, Sugimura H, Kino I: Aislamiento de ADN complementario que codifica K-cadherina, una nueva cadherina de rata expresada preferentemente en riñón y riñón fetal carcinoma. Cancer Res. 1994, 54: 3034-3041.

    Berndorff D, Gessner R, Kreft B, Schnoy N, Lajouspetter AM., Loch N, Reutter W, Hortsch M, Tauber R: Cadherina hígado-intestino: Clonación molecular y caracterización de una nueva molécula de adhesión celular dependiente de Ca2 + expresada en hígado y intestino. J Cell Biol. 1994, 125: 1353-1396.

    Schneider R: El protooncogén humano ret: ¿Una cadherina comunicativa ?. Trends Biochem Sci. 1992, 17: 468-469. 10.1016 / 0968-0004 (92) 90490-Z.

    Iwamoto T, Taniguchi M, Asai N, Ohkusu K, Nakashima I, Takahashi M: clonación de ADNc del protooncogén ret de ratón y su similitud de secuencia con la superfamilia cadherina. Oncogén. 1993, 8: 1087-1091.

    Larue L, Ohsugi M, Hirchenhain J, Kemler R: los embriones mutantes nulos de E-cadherina no logran formar un epitelio de trofectodermo. Proc Natl Acad Sci USA. 1994, 91: 8263-8267.

    Fleming T, Hay M, Javed Q: diferenciación epitelial y formación de uniones intercelulares en el embrión temprano de ratón. Suplemento de desarrollo 1992, 17: 105-113.

    Hyafil F, Morello D, Babinet C, Jacob F: una glicoproteína de la superficie celular involucrada en la compactación de células de carcinoma embrionario y embriones en etapa de escisión. Celda. 1980, 21: 927-934.

    Vestweber D, Kemler R: El antisuero de conejo contra una glicoproteína de superficie purificada descompacta los embriones de preimplantación de ratón y reacciona con tejidos adultos específicos. Exp Cell Res. 1984, 152: 169-178.

    Sefton M, Johnson M., Clayton L: Síntesis y fosforilación de uvomorulina durante el desarrollo temprano del ratón. Development (Cambridge, Reino Unido). 1992, 115: 313-318.

    Thiery JP: Transiciones epitelio-mesenquimatosas en la progresión tumoral. Nat Rev Cancer. 2002, 2: 442-454. 10.1038 / nrc822.

    Babb SG, Barnett J, Doedens AL, Cobb N, Liu Q, Sorkin BC, Yelick PC, Raymond PA, Marrs JA: E-cadherina de pez cebra: Expresión durante la embriogénesis temprana y regulación durante el desarrollo cerebral. Dev Dyn. 2001, 221: 231-237. 10.1002 / dvdy.1132.

    Hulsken J, Birchmeier W, Behrens J: E-cadherin y APC compiten por la interacción con β-catenin y el citoesqueleto. J Cell Biol. 1994, 127: 2061-2069.

    Morin PJ, Sparks AB, Korinek V, Barker N, Clevers H, Vogelstein B, Kinzler KW: Activación de la señalización de β-catenina-Tcf en cáncer de colon por mutaciones en β-catenina o APC. Ciencias. 1997, 275: 1787-1790. 10.1126 / science.275.5307.1787.

    Pece S, Gutkind JS: Señalización de E-cadherina a la vía MAPK mediante el reclutamiento y activación de los receptores del factor de crecimiento epidérmico tras la formación del contacto célula-célula. J Biol Chem. 2000, 275: 41227-41233. 10.1074 / jbc.M006578200.

    Entorno de conocimiento de transducción de señales. [http://www.stke.org]

    Peifer M, Polakis P: Señalización Wnt en Oncogénesis y Embriogénesis: una mirada fuera del núcleo. Ciencias. 2000, 287: 1606-1609. 10.1126 / science.287.5458.1606.

    Efstathiou JA, Liu D, Wheeler JMD, Kim HC, Beck NE, Ilyas M., Karayiannakis AJ, Mortensen NJMcC, Kmiot W, Playford RJ, Pignatelli M, Bodmer WF: la cadherina epitelial mutada se asocia con un aumento de la tumorigenicidad y pérdida de adhesión y de la capacidad de respuesta al factor 2 del trébol motogénico en las células del carcinoma de colon. PNASOnline. 1999, 96: 2316-2321. 10.1073 / pnas.96.5.2316.

    Berx G, Becker KF, Hofler H, van Roy F: mutaciones del gen de cadherina E humana (CDH1). Hum Mutat. 1998, 12: 226-237. 10.1002 / (SICI) 1098-1004 (1998) 12: 4 & lt226 :: AID-HUMU2 & gt3.0.CO2-D.

    Machado JC, Soares P, Carneiro F, Rocha A, Beck S, Blin N, Berx G, Sobrinho-Simoes M: las mutaciones del gen E-cadherina proporcionan una base genética para la divergencia fenotípica de carcinomas gástricos mixtos. Lab Invest. 1999, 79: 459-465.

    Christofori G, Semb H: El papel de la molécula de adhesión celular E-cadherina como gen supresor de tumores. Trends Biochem Sci. 1999, 24: 73-76. 10.1016 / S0968-0004 (98) 01343-7.

    Guilford P, Hopkins J, Harraway J, McLeod M, McLeod N, Harrawira P, Taite H, Scoular R, Millers A, Reeve A: mutaciones de la línea germinal de E-cadherina en el cáncer gástrico familiar. Naturaleza. 1998, 392: 402-405. 10.1038 / 32918.

    Huiping C, Sigurgeirsdottir JR, Jonasson JG, Eiriksdottir G, Johannsdottir JT, Egilsson V, Ingvarsson S: Alteraciones cromosómicas y mutaciones del gen E-cadherina en el cáncer de mama lobulillar humano. Br J Cancer. 1999, 81: 1103-1110. 10.1038 / sj.bjc.6690815.

    Bukholm IK, Nesland JM, Børessen-Dale AL: Reexpresión de E-cadherina, α-catenina y β-catenina, pero no de γ-catenina, en tejido metastásico de pacientes con cáncer de mama. J Pathol. 2000, 190: 15-19. 10.1002 / (SICI) 1096-9896 (200001) 190: 1 & lt15 :: AID-PATH489 & gt3.3.CO2-C.

    Ilyas M: expresión de moléculas de adhesión en cáncer de mama: ¿el fénix en la metástasis tumoral ?. J Pathol. 2000, 190: 3-5. 10.1002 / (SICI) 1096-9896 (200001) 190: 1 & lt3 :: AID-PATH490 & gt3.0.CO2-5.

    Tycko B: Silenciamiento génico epigenético en cáncer. J Clin Invest. 2000, 105: 401-407.

    Becker KF, Atkinson MJ, Reich U, Becker I, Nekarda H, Siewert JR, Hoefler H: las mutaciones del gen E-Cadherin proporcionan pistas para los carcinomas gástricos de tipo difuso. Cancer Res. 1994, 54: 3845-3852.

    Richards FM, McKee SA, Rajpar MH, Cole TRP, Evans DGR, Jankowski JA, McKeown C, Sanders DSA, Maher ER: Las mutaciones del gen de la cadherina E de la línea germinal (CDH1) predisponen al cáncer gástrico familiar y al cáncer colorrectal. Hum Mol Genet. 1999, 8: 607-610. 10.1093 / hmg / 8.4.607.

    Gayther SA, Gorringe KL, Ramus SJ, Huntsman D, Roviello F, Grehan N, Machado JC, Pinto E, Seruca R, Halling K, MacLeod P: Las mutaciones del gen de la cadherina E de la línea germinal (CDH1) predisponen al cáncer gástrico familiar y al cáncer colorrectal . Hum Mol Genet. 1999, 8: 607-610. 10.1093 / hmg / 8.4.607.

    Chun YS, Lindor NM, Smyrk TC, Petersen BT, Burgart LJ, Guilford PJ, Donohue JH: Mutaciones del gen de la cadherina E de la línea germinal: ¿está indicada la gastrectomía total profiláctica ?. Cáncer. 2001, 92: 181-187. 10.1002 / 1097-0142 (20010701) 92: 1 & lt181 :: AID-CNCR1307 & gt3.0.CO2-J.

    Risinger JI, Berchuck A, Kohler MF, Boyd J: Mutaciones del gen E-cadherina en cánceres ginecológicos humanos. Nature Genet. 1994, 7: 98-102.

    Pećina-Šlaus N, Pavelić K, Pavelić J: Pérdida de heterocigosidad y expresión de proteínas del gen APC en carcinomas de células renales. J Mol Med. 1999, 77: 446-453. 10.1007 / s001090050375.

    Ionov Y, Peinado MA, Malkhosyan S, Shibata D, Perucho M: mutaciones somáticas ubicuas en secuencias simples reparadas revelan un nuevo mecanismo para la carcinogénesis colónica. Naturaleza. 1993, 363: 558-561. 10.1038 / 363558a0.


    Ver el vídeo: EL COMPLEJO PRINCIPAL DE HISTOCOMPATIBILIDAD I. (Mayo 2022).