Información

Infecciones entre especies

Infecciones entre especies


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Escuché que el VIH se desarrolló a partir del VIS, etc.

También escuché que la mayoría de las especies (incluida la mayoría de los monos) no pueden contraer un resfriado común como los humanos.

Entonces, ¿qué hace que las infecciones puedan viajar entre especies o viceversa?

Por el bien de la pregunta, reduciré el alcance. Digamos que tenemos un virus que puede infectar a los humanos, pero no infectar a parientes humanos cercanos, como los chimpancés. ¿Qué pasa con la biología del virus o la biología animal que causa esa diferencia?

Sé que con algunos animales se trata de la temperatura corporal o la composición de la piel, etc. Pero los humanos y los chimpancés son físicamente bastante similares. ¿Se trata de las diferencias inmunológicas?


Los virus evolucionan junto con sus anfitriones. Si intercambiaras un cromosoma humano en una célula de chimpancé por el cromosoma de chimpancé correspondiente, habría muchas similitudes genéticas, pero también surgirían un montón de incompatibilidades porque los genes de cada cromosoma han evolucionado independientemente del resto del genoma.

Los virus interactúan con su genoma huésped en muchas etapas. Primero, necesitan una forma de identificar a sus huéspedes objetivo (células) en el medio ambiente y obtener acceso a las células. Lo hacen reconociendo marcadores en la superficie celular. Para algo como el VIH, esta identificación es mucho más específica que identificar solo a los humanos: están identificando células inmunes particulares.

Una vez dentro, los virus interactúan con el huésped para expresar genes virales, producir y ensamblar nuevos viriones y se transmiten a los huéspedes posteriores. Si ocurre una incompatibilidad en cualquiera de estas etapas, el virus no podrá replicarse.

Sin embargo, debido a que existe mucha homología entre especies relacionadas, es factible que un virus infecte a más de un huésped. Si un virus evoluciona en un contexto en el que comúnmente infecta a varios hosts, puede haber presiones selectivas para que mantenga esas capacidades en todos los hosts. Alternativamente, las presiones selectivas pueden hacer que el virus evolucione en linajes separados, uno infectando a los patos y otro a los gorriones, por ejemplo.

Para un virus que es específico de un determinado anfitrión (o rango de anfitriones), es probable que tenga dificultades en otro anfitrión fuera del contexto en el que evolucionó. Sin embargo, también existe variabilidad en los genomas virales, y si muchas copias virales se exponen a un huésped nuevo, existe la posibilidad de que algunas de ellas puedan sobrevivir en ese huésped. Esto seleccionará esos genes virales particulares, y las generaciones virales subsiguientes se seleccionarán adicionalmente por rasgos que ayuden a replicarse en ese huésped.

Las reacciones inmunes también podrían influir, pero en la mayoría de los casos es la especialización de los propios virus la clave para la especificidad del hospedador.


Ahlquist, P., Noueiry, A. O., Lee, W. M., Kushner, D. B. y Dye, B. T. (2003). Factores del huésped en la replicación del genoma del virus de ARN de cadena positiva. Revista de virología, 77 (15), 8181-8186.

Hao, L., Sakurai, A., Watanabe, T., Sorensen, E., Nidom, C. A., Newton, M. A.,… y Kawaoka, Y. (2008). El cribado de ARNi de Drosophila identifica genes del huésped importantes para la replicación del virus de la influenza. Naturaleza, 454 (7206), 890.

Schild, G. C., Oxford, J. S., De Jong, J. C. y Webster, R. G. (1983). Evidencia de la selección de la célula huésped de variantes antigénicas del virus de la influenza. Nature, 303 (5919), 706.


La clave más importante para comprender los virus y sus huéspedes (más específicamente, las células huésped) es la estructura de la proteína externa (membrana y ECM).

Como regla general, los virus deben adherirse a sus células huésped. Algunos virus abusan de los mecanismos de transporte para engañar a las células huésped para que "las coman" y ejecuten su contenido. Otros tipos de virus tienen pinzas de aspecto desagradable (el ejemplo más destacado que me viene a la mente son los bacteriófagos) que se apoderan de estructuras específicas en las células huésped, mientras que la pieza central del virus perfora un agujero en la membrana de la célula huésped para alimentarla con ADN / ARN malicioso y enzimas.

Las infecciones entre especies suelen abusar de estructuras comunes a muchas especies. Por ejemplo, los receptores de ácido siálico suelen ser objeto de abuso como puntos de entrada de virus (consulte https://www.ncbi.nlm.nih.gov/pubmed/23873408). Si los humanos tuvieran soporte genómico al igual que los sistemas operativos de las computadoras reciben actualizaciones para componentes vulnerables, los receptores de ácido siálico se habrían etiquetado como un riesgo crítico hace milenios y se habrían parcheado.

Obviamente, hay otros factores que pueden frustrar la infección entre especies. Un virus de especies cruzadas exitoso necesita utilizar un subconjunto de operaciones soportadas mínimo de funciones celulares comunes a sus anfitriones. Si una célula huésped potencial (por coincidencia de estructura externa) no puede producir una pieza necesaria para la replicación viral, falla. Si una célula huésped potencial (o el propio huésped, en el caso de formas de vida multicelulares) se construye con algunas medidas antiinfecciosas extrañas (por ejemplo: detección de manipulación, verificación de integridad antes de producir proteína a partir de ARN o inmunidad inesperadamente robusta ), la infección podría fallar de todos modos.


Derrame: cómo los virus pasan de los animales a los humanos

Un desbordamiento o transmisión entre especies es la capacidad de un virus extraño de saltar de una especie a una nueva especie hospedadora y propagarse dentro de la población de esa nueva especie hospedadora. Tenga en cuenta que las enfermedades causadas por patógenos que infectan tanto a poblaciones animales como humanas se denominan generalmente zoonosis. Aparte de los virus, varias bacterias, hongos y parásitos son zoonóticos.

Sin embargo, en algunos incidentes, después de que un patógeno ha saltado de una especie a otra, muta y se convierte en una nueva cepa capaz de replicarse, propagarse y evolucionar de manera eficiente y exclusiva dentro de la nueva población huésped. Ésta es la definición principal o un desbordamiento de la transmisión entre especies.

Varios virus notables habían saltado de los animales y se habían convertido en patógenos exclusivos de la población humana. Además, algunos de ellos se han convertido en importantes amenazas para la salud pública, provocando epidemias y pandemias. Estos incluyen VIH-SIDA, enfermedades debidas a coronavirus humanos como SARS y MERS, fiebre del Ébola, influenza aviar o gripe aviar, influenza porcina y COVID-2019.


Las infecciones entre especies amenazan tanto la salud humana como la biodiversidad

Crédito: Alison Peel

La propagación de enfermedades entre especies es un problema de "salud única" que afecta tanto a la salud humana como a la conservación de la vida silvestre, según un nuevo conjunto de artículos publicados hoy por científicos de la Royal Society y ZSL.

El número especial de Transacciones filosóficas de la Royal Society B analiza la propagación de enfermedades infecciosas, como el SARS, la gripe aviar y la gripe porcina, de una especie a otra y cómo no solo está causando problemas a los humanos, sino que también está amenazando la conservación de la vida silvestre y la supervivencia de poblaciones grandes y robustas.

Los documentos afirman que la mayoría de las enfermedades amenazadoras son causadas por infecciones que se mueven entre especies, donde una especie actúa como reservorio y luego infecta a otra especie, más vulnerable, que puede sufrir altas tasas de mortalidad.

El Dr. Andrew Cunningham de ZSL escribe que el problema requiere una solución integral y transdisciplinaria. Se discuten nuevas formas de abordar la investigación y el control de enfermedades, así como recomendaciones para los responsables de la formulación de políticas.


¿Cuáles son el rango de hospedadores y los reservorios de animales para HEV?

La reciente identificación genética de cepas de HEV de varias especies animales ha ampliado significativamente la gama de huéspedes y la diversidad genética del virus [4, 7]. Además de los seres humanos, el VHE se ha identificado genéticamente a partir de numerosas otras especies animales, incluidos los cerdos, ciervos, conejos, mangostas, pollos, camellos, ratas, hurones, bandicoot mayor, musaraña almizclera asiática, visones, alces y peces (Tabla 1) [8,9]. Las cepas animales bien caracterizadas de HEV incluyen los genotipos 3 y 4 de HEV porcino de cerdos domésticos y salvajes, HEV de conejo genotipo 3 y HEV aviar de pollos. Además de humanos y cerdos, también se han identificado cepas de HEV de genotipo 3 en conejos, ciervos y mangostas. Las ratas y los hurones portan cepas relacionadas con HEV que son genéticamente distintas de otras HEV de mamíferos y aves (Tabla 1). Los grupos de HEV de los alces dentro de las especies Orthohepevirus A forman un clado distinto con un ancestro común a los virus de los genotipos 1 & # x020136 [9,10]. El virus de la trucha degollada se asemeja a los hepevirus de mamíferos en su organización genómica (Fig. 1) a pesar de una baja identidad de secuencia de nucleótidos [11] y representa un género separado Piscihepevirus. La identificación genética de estas diversas cepas animales de HEV brindó oportunidades para desarrollar nuevos modelos animales de origen natural para HEV.

Además, también se ha informado evidencia serológica de infección por HEV en varias otras especies animales, aunque la fuente de seropositividad en estas especies aún no se ha identificado genéticamente. Se informa que los anticuerpos anti-HEV se detectan en varias especies de rumiantes como cabras, bovinos y ovejas, así como en perros y gatos sin detección de secuencias relacionadas con HEV. La identificación genética definitiva de las fuentes de seropositividad al HEV en estas especies animales conducirá al descubrimiento de nuevas cepas animales del HEV y, por lo tanto, a una mayor expansión de la gama de huéspedes del HEV.


Materiales y métodos

Declaración de Ética

Se tomaron muestras de sangre de sujetos humanos, de entre 18 y 70 años de edad, después de que se obtuvo el consentimiento informado por escrito de todos los sujetos. Todos los protocolos experimentales que involucran muestras humanas fueron aprobados por el Comité de Ética del Hospital de la Universidad Nacional de Kangwon (IRB No. 2014-08-008-002), el Comité de Ética Médica de la Universidad de Malaya (Ref No. 817.18) y el Comité de Ética de Investigación Médica ( MREC), Ministerio de Salud, Malasia (Registro Nacional de Investigación Médica ID No. 13079), de acuerdo con las pautas y regulaciones pertinentes. Se recolectaron muestras de sangre de PAG. knowlesipacientes infectados en tubos vacutainer con EDTA proporcionados por el Centro Médico de la Universidad de Malaya (UMMC), Malasia durante 2010-2013, el día en que los pacientes fueron diagnosticados positivamente con malaria. Todos PAG. knowlesi las muestras utilizadas para este estudio se confirmaron mediante PCR específica de especie, como se describe en otro lugar [4]. El suero de los pacientes se extrajo de pacientes sintomáticos que visitaban áreas endémicas de Malasia con parasitemia de 0,207% en promedio (rango de 0,003 a 1,380%) y una edad promedio de 38 años (rango de 6 a 72). Sin embargo, no obtuvimos información sobre los antecedentes de infección previa por malaria de los pacientes. PAG. vivax-los pacientes infectados fueron reclutados de un PAG. vivax-área endémica en la provincia de Gangwon, República de Corea (ROK) donde PAG. vivax es importante Plasmodium especie, no hay PAG. knowlesi infección en esta zona [1]. Pacientes con PAG. falciparum La infección fue excluida en este estudio. Los sueros se obtuvieron de pacientes sintomáticos que acudieron a centros de salud y clínicas locales en la provincia de Gangwon, República de Corea con parasitemia en un rango de 0,027 a 0,630%, media de 0,121%) y de 18 a 60 años (media de 28). PAG. vivax y PAG. knowlesi Se combinaron ocho muestras de suero de pacientes después de una PCR específica de la especie y ocho individuos sanos sin ninguna Plasmodium infección. Un total de 70 personas PAG. vivax-, PAG. knowlesiEl suero de los pacientes infectados y los individuos sanos se utilizaron para la inmunodetección individual después de la selección preliminar de suero combinado. Los pacientes sin malaria fueron reclutados de una población de individuos sanos que vivían en áreas no endémicas de la República de Corea. La negatividad del paludismo fue confirmada por microscopía y PCR.

Análisis de secuencia de identidad de aminoácidos

Los antígenos diana se seleccionaron de nuestros estudios anteriores que se localizaron en diferentes organelos apicales / superficie de merozoitos de PAG. vivax y fueron reconocidos por el suero de pacientes humanos (Tabla 1, ver referencias). Secuencias de aminoácidos de PAG. vivax (Cepas Sal I y P01) y PAG. knowlesi (Cepa H) se recuperaron de PlasmoDB (www.plasmodb.org) [32] y se alinearon. Se usó el programa Clustal W para hacer una alineación por pares para determinar el porcentaje de identidad de aminoácidos (Tabla 1 y Fig. S1).

Cultivo in vitro de sangre en estadio PAG. knowlesi parásitos

El humano adaptado PAG. knowlesi La cepa A1-H.1 se mantuvo con eritrocitos humanos frescos en medio basado en RPMI 1640 (Invitrogen / Life Technologies, Grand Island, NY) como se describió anteriormente [53].

Expresión de proteína recombinante

PAG. vivax Las proteínas recombinantes fueron generadas por células de germen de trigo libres o mi. coli sistemas de expresión en nuestros estudios anteriores [25, 42, 44, 50]. fragmentos de ADN que codifican PvRBP1a-34, Pv41, o PvRhopH2 se amplificaron a partir de un aislado vivax coreano con cebadores PvRBP1a-34_F (ggtcgcggatcc GAATTC ATGAACGAACTAGGTATAGACATT) y PvRBP1a-34_R (ggtggtggtg CTCGAG TTCAAACTCTATCTTCAGTTC) Pv41_F (ggtcgcggatcc GAATTC ATGGAACACATCTGCGATTTTAC) y Pv41_R (ggtggtggtg CTCGAG CTCCTGGAAGGACTTGGCA) y PvRhopH2_F (ggtcgcggatcc gaattc ATGGAGCTGAGCCACAGC) y PvRhopH2_R (ggtggtggtg ctcgag CTTCTCCACATCCTCGTGGT), respectivamente. Las letras pequeñas indican la secuencia derivada del plásmido y las letras subrayadas indican los sitios de restricción de la enzima, EcoRI y XhoI, respectivamente. Se utilizó el kit KOD-plus de alta fidelidad (Toyobo Co., Osaka, Japón) con un paso de desnaturalización inicial a 94 ° C durante 2 minutos, seguido de 35 ciclos de 94 ° C durante 15 segundos, 60 ° C durante 30 segundos, y 58 ° C durante 1,5 min y un paso de extensión final a 68 ° C durante 10 min. Los amplicones se purificaron usando un kit de extracción en gel y se ligaron en el vector de expresión pET28a (+) (Novagen, Madison, WI) para PvRBP1a-34 o el vector de expresión pET23a (+) para Pv41 y PvRhopH2 con una etiqueta His. Los plásmidos correctamente ligados se transformaron en mi. coli BL21 (DE3) pLysS (Life Technologies) para la expresión de proteínas recombinantes. La expresión de la proteína recombinante se indujo con isopropil-β-D-tiogalactopiranósido 0,1 mM (IPTG Sigma-Aldrich, St. Louis, MO). Todas las proteínas recombinantes se solubilizaron, purificaron y replegaron como se describe en otra parte [47, 54].

Mientras tanto, PAG. knowlesi Las proteínas recombinantes se expresaron para este estudio utilizando un sistema libre de células de germen de trigo para inmunocribado utilizando cebadores específicos (Tabla S2), los procedimientos se describieron en otra parte [47]. La expresión de la proteína recombinante PkDBPα se describió en otro lugar [47]. El fragmento de ADN que codifica PkRhopH2 se amplificó a partir de PAG. knowlesi ADN genómico A1-H.1 con par de cebadores PkRhopH2_F (ggtcgcggatcc gaattc ATGGAGTTAGGCCATACCGTG) y PkRhopH2_R (ggtggtggtg ctcgag CTTCTCGATGTCTTCGTAGTCCA). Las letras minúsculas indican la secuencia derivada del plásmido y las letras subrayadas indican los sitios de restricción enzimática para EcoRI y XhoI, respectivamente. Se utilizó un kit KOD-plus de alta fidelidad con un paso de desnaturalización inicial a 94 ° C durante 2 minutos, seguido de 35 ciclos de 94 ° C durante 15 segundos, 60 ° C durante 30 segundos y 58 ° C durante 1,5 minutos y un paso de extensión final a 68 ° C durante 10 min. Los amplicones se purificaron usando un kit de extracción en gel y se ligaron en el vector de expresión pET28a (+) con una etiqueta His. Los plásmidos correctamente ligados se transformaron en mi. coli BL21 (DE3). La expresión y purificación de proteínas se realizó como se describió anteriormente. PAG. knowlesi La proteína MSP1-19 se clonó en el vector pGEX-4T-2 (GE Healthcare Life Sciences, Uppsala, Suecia) mediante clonación In-Fusion de acuerdo con el manual del fabricante, y los pDNA clonados se transformaron en células BL21 (DE3) competentes para la expresión de proteínas recombinantes. . Las proteínas se purificaron con glutatión sefarosa 4B (GE Healthcare Life Sciences) y se usaron para la producción de anticuerpos de ratones.

SDS-PAGE y análisis de western blot

Los lisados ​​de parásitos se prepararon a partir de PAG. knowlesi esquizontes como se describió anteriormente [55]. Las proteínas recombinantes se separaron mediante SDS-PAGE al 13% en condiciones reductoras o no reductoras y se tiñeron con azul brillante de Coomassie al 0,25% R-250 (Sigma-Aldrich) y se utilizaron para análisis de transferencia Western [25]. Las proteínas transferidas a la membrana se hicieron reaccionar con suero policlonal de conejo primario (1:50) o un anticuerpo monoclonal anti-His (1: 2,000, Hilden, Hamburgo, Alemania) y luego reaccionaron con anti-conejo de cabra o anti-cabra de cabra marcado con IRDye secundario. -anticuerpos de ratón (1: 10.000) (LI-COR Bioscience, Lincoln, NE). Se utilizaron un sistema de imágenes infrarrojas Odyssey (LI-COR Bioscience) y el software Odyssey (LI-COR Bioscience) para visualizar las bandas.

Producción de anticuerpos animales y purificación de IgG

Todos PAG. vivax Los anticuerpos específicos de antígeno en estadio sanguíneo se obtuvieron durante nuestros estudios anteriores (Tabla 1, Tabla S3). La IgG total se purificó a partir de 1 ml de suero de conejo utilizando una columna de proteína G HP de acuerdo con el protocolo del fabricante (GE Healthcare Life Sciences) como se describe en otra parte [47]. Todos los protocolos experimentales con animales fueron aprobados por el Comité de Ética Institucional y siguieron las Pautas éticas para experimentos con animales de la Universidad Nacional de Kangwon (KIACUC-16-0158).

Purificación de anticuerpos IgG específicos de antígeno a partir de muestras de suero de pacientes

Las muestras de suero utilizadas en este estudio se combinaron de ocho PAG. vivax-pacientes infectados de la República de Corea con una alta respuesta al antígeno particular de interés, que se cribó mediante inmuno cribado con una micromatriz de proteínas. El control comprendía muestras de suero combinadas de ocho individuos sanos de un área no endémica de la República de Corea. Los anticuerpos IgG totales se purificaron de las muestras de suero combinadas utilizando columnas de proteína G de acuerdo con el protocolo del fabricante (GE Healthcare Life Sciences). Los anticuerpos IgG aislados se dializaron contra medio RPMI 1640 y se concentraron usando dispositivos centrífugos (Merck Millipore, Darmstadt, Alemania) con un valor de corte de 30 kDa a una concentración de 10 a 20 mg / ml. Las proteínas recombinantes PvRBP1a, Pv41 y PvRhopH2 (2-3 mg cada una) se inmovilizaron en perlas de flujo rápido de Sepharose 4 activadas con bromuro de cianógeno (CNBr) (GE Healthcare Life Sciences) de acuerdo con las instrucciones del fabricante. Los anticuerpos IgG aislados totales (0,5 ml) se cargaron en la columna llena con perlas acopladas al antígeno y se eluyeron usando un tampón de elución (glicina 0,1 M, pH 2,7). Las IgG específicas de antígeno eluidas se neutralizaron inmediatamente con un tampón Tris (pH 9,0) y se dializaron contra medio RPMI 1640 incompleto hasta la concentración deseada.

Ensayo de inmunofluorescencia (IFA)

Se realizó una IFA como se describió anteriormente [47]. Los portaobjetos se probaron con dos sondas con un panel de suero policlonal de conejo contra PAG. vivax antígenos (1:50) y suero de ratones contra PAG. knowlesi antígenos como marcadores de localización (PkMSP1-19 para superficie de merozoito, PkDBPα-II para micronema y PkRhopH2 para rhoptry 1:50). Como anticuerpos secundarios se utilizaron Alexa Fluor 488 de cabra anti-IgG de ratón (H + L) y Alexa Fluor 568 de cabra-anti-IgG de conejo (H + L). Los núcleos se tiñeron con 4 ', 6-diamidino-2-fenilindol (DAPI, Invitrogen). ImageJ analizó las intensidades de los píxeles rojos y verdes. A continuación, se compararon los gráficos de dispersión de las intensidades de píxeles rojos y verdes individuales y se comparó el coeficiente de determinación (r-cuadrado) se obtuvo. El mas largo r-squared (lo más cercano al 100%) representa el valor de dispersión alrededor de la línea de regresión que sugiere la variación de las intensidades de píxeles rojos y verdes alrededor de su media. La colocalización se determinó como superposición espacial entre las intensidades de píxeles rojos (control) y verdes, como se muestra en r-valor al cuadrado.

Microarreglo de proteínas

El protocolo de microarrays de proteínas se describió en otro lugar [25]. El suero se combinó de ocho PAG. vivax- y PAG. knowlesi-pacientes infectados, donantes sanos y / o utilizados individualmente sin agrupar para evaluar la inmunorreactividad cruzada. El colectivo o individual PAG. vivax- o PAG. knowlesiEl suero del paciente infectado o el suero sano se diluyeron a 1:25. El valor de corte fue igual a la intensidad de fluorescencia media (MFI) más dos desviaciones estándar (SD) de las muestras negativas. Los valores de MFI normalizados se calcularon a partir de los valores de MFI / cut-off. El MFI normalizado para el suero del paciente combinado se restó del MFI normalizado correspondiente para el suero sano combinado.

Ensayo de inhibición del crecimiento

El protocolo estandarizado para el ensayo de inhibición de la invasión se ha descrito en otro lugar [47]. Brevemente, se agregaron 2 mg / ml de anticuerpos IgG de conejo purificados y un gradiente de concentración de anticuerpos IgG específicos de antígeno de los pacientes (0,1, 0,2 y 0,5 mg / ml) a una placa de cultivo de 96 pocillos que contenía PAG. knowlesi esquizontes con parasitemia inicial del 1,5% y hematocrito del 2% de eritrocitos humanos frescos. Se obtuvo un anticuerpo monoclonal anti-Fy6 (25 μg / mL), que reconoce el epítopo 2C3 en la región N-terminal de DARC ubicada en la membrana de la superficie de los glóbulos rojos, como se describió previamente [56]. Este anticuerpo fue un amable obsequio del Dr. Olivier Bertrand y el Dr. Yves Colin (Institut National de la Transfusion Sanguine, París, Francia). Después de 10 h de posinvasión para PAG. knowlesi, los parásitos se tiñeron con SYBR Green I (Sigma-Aldrich) y se analizaron con un citómetro de flujo Accuri C6 (Accuri cytometer Inc., Ann Arbor, MI). Se realizaron dos experimentos independientes por duplicado, tres experimentos independientes por duplicado no fueron posibles debido a la cantidad limitada de anticuerpos.

Análisis de los datos

Todos los cálculos y análisis de datos se realizaron con GraphPad PRISM 5 (GraphPad Software, Inc., San Diego, CA). Se utilizó la prueba de Mann-Whitney para evaluar las diferencias entre las medias, y se utilizó ANOVA unidireccional con la prueba de Dunnett para comparar las medias de más de dos grupos con intervalos de confianza (IC) del 95% anti-HisGST de control, y pag & lt 0,05 se consideró significativo. La concentración inhibidora del 50% (IC50) se representó gráficamente frente a las concentraciones de anticuerpos transformadas logarítmicamente, y se utilizó el ajuste de la curva mediante regresión no lineal con el software Excel para identificar el 50% de inhibición del crecimiento del parásito. La agrupación jerárquica se utilizó para calcular el perfil de seropositividad individual utilizando el software TIGR multiarray experiment viewer (MeV) [57]. El análisis de agrupamiento se realizó utilizando el agrupamiento de ligamiento promedio con la distancia euclidiana como una métrica de similitud.


Infecciones entre especies y su análisis

AbstractoLa capacidad de ciertos patógenos para infectar múltiples hospedadores ha llevado al desarrollo de hospedadores no vertebrados genéticamente manejables para dilucidar los mecanismos moleculares de interacciones entre estos patógenos y sus hospedadores. El uso de hospedadores de plantas, insectos, nematodos y protozoos para estudiar patógenos humanos ha facilitado el esclarecimiento de la naturaleza molecular de la patogénesis y las respuestas del hospedador. Los análisis de la virulencia de patógenos de múltiples hospedadores en sus respectivos hospedadores revelaron que los patógenos utilizan muchas estrategias ofensivas universales para superar las defensas del hospedador, independientemente del linaje evolutivo del hospedador. Asimismo, las disecciones genéticas de la respuesta de defensa de los huéspedes no vertebrados también han demostrado que las características clave que subyacen a las respuestas de defensa del huésped están muy conservadas. Esta revisión resume cómo la información obtenida del análisis de infecciones entre especies contribuye a nuestra comprensión de las interacciones huésped-patógeno.


4. DISCUSIÓN

En este estudio, hemos realizado un análisis evolutivo utilizando 272 secuencias genómicas de coronavirus obtenidas de varias ubicaciones geográficas. Nuestros resultados muestran que la nueva secuencia de coronavirus obtenida del brote de neumonía viral que se produjo en la ciudad de Wuhan forma un grupo separado que es muy distintivo del SARS-CoV. El SARS-CoV surgió por primera vez en China en 2002 y luego se extendió a 37 países / regiones en 2003 y provocó un brote mundial relacionado con los viajes con una tasa de mortalidad del 9,6%. 26 Más importante aún, los resultados de nuestro análisis revelan que puede ocurrir una recombinación homóloga entre el coronavirus de murciélago y un coronavirus de origen desconocido dentro del gen de la glicoproteína de pico viral. El análisis de homología de secuencia de los genes de glicoproteína de pico parcial (1-783 pb) del 2019-nCoV se realizó a través de BLAST en el sitio web del NCBI. Curiosamente, no se encontró una secuencia similar con una secuencia conocida en la base de datos, lo que sugiere que todavía se desconoce un virus parental de recombinación putativo. Un estudio anterior sugirió que la recombinación del SARS en los genes de la glicoproteína de pico podría haber mediado el evento inicial de transmisión cruzada de especies de murciélagos a otros mamíferos. 27 El análisis del gráfico de Bootscanning (datos no mostrados) sugirió que los principales padres del 2019-nCoV se originaron en el Clado A (bat-SL-CoVZC45 y bat-SL-CoVZXC21) pero formaron un grupo monofilético diferente de ellos. En general, el origen ancestral del 2019-nCoV fue más probable de especies hospedadoras divergentes que del SARS-CoV.

El rango de hospedadores de algunos coronavirus animales era promiscuo. 7 Llamaron nuestra atención solo cuando causaron enfermedades humanas como el SARS, el MERS y la neumonía 2019-nCoV. 4, 9, 28 Es fundamental determinar el reservorio animal del 2019-nCoV para comprender el mecanismo molecular de su propagación entre especies. La recombinación homóloga dentro de las proteínas estructurales virales entre coronavirus de diferentes hospedadores puede ser responsable de la transmisión de "especies cruzadas". 27 La información obtenida del análisis de RSCU proporciona algunas ideas sobre la cuestión del reservorio de animales silvestres, aunque requiere una mayor validación mediante estudios experimentales en modelos animales. Actualmente, el 2019-nCoV no se ha aislado de especies animales, aunque se obtuvo de un paciente. Identificar y caracterizar el reservorio animal de 2019-nCoV será útil para investigar la recombinación y para comprender mejor su propagación de persona a persona entre las poblaciones humanas.

El 2019-nCoV ha causado un total de 217 casos confirmados de neumonía en China al 20 de enero de 2020 y también se han notificado nuevos pacientes en Hong Kong, Tailandia, Singapur, Corea del Sur y Japón. A diferencia del SARS-CoV, el 2019-nCoV pareció causar inicialmente una forma leve de neumonía viral y tiene una capacidad limitada de propagación de persona a persona. Esto podría deberse a la recombinación que se produjo dentro de la glicoproteína de unión al receptor. Sin embargo, existe una preocupación acerca de su adaptación en humanos que pueden adquirir la capacidad de replicarse de manera más eficiente y propagarse más rápidamente a través del contacto cercano de persona a persona.

En resumen, los resultados derivados de nuestro análisis evolutivo sugieren que 2019-nCoV tiene la información genética más similar con el coronovirus de murciélago y tiene el sesgo de uso de codones más similar con la serpiente. Además, puede producirse una recombinación homóloga dentro de la glicoproteína de pico de unión al receptor viral, que puede determinar la transmisión entre especies. Estos nuevos hallazgos justifican una investigación futura para determinar experimentalmente si la recombinación homóloga dentro de la glicoproteína de pico determina el tropismo del 2019-nCoV en la transmisión y replicación viral. La nueva información obtenida de nuestro análisis evolutivo es altamente significativa para el control efectivo del brote causado por la neumonía inducida por 2019-nCoV.


La persistencia selecciona mutantes del rango de hospedadores del MHV.

Figura 2 . Expresión persistente del antígeno del virus en células HepG2. Los cultivos de líneas celulares HepG2 en cámaras LabTek de ocho cámaras se infectaron con V51B (A), V10B (B), V30B (C) o MHV-A59 (D) a una MOI de 5 durante 1 h. Los cultivos se tiñeron con antisuero policlonal MHV-A59 a las 18 h de la infección.

El antisuero hCEA bloquea la entrada persistente del virus en las líneas celulares humanas.

AnticuerpoBloqueo de V51B en células HepG2 Reactividad cruzada del antígeno hCEA a
Bgp1CGM6NCACGM1CEACGM7
Monoclonal
Col-1+++
Col-6??+?
Col-12+? a ???+?
Col-4++++
Col-14+????+?
Kat4c++++
pCEA (policlonal)+++++++
Fig. 3 . Experimentos de bloqueo en células HepG2. Los cultivos de células HepG2 en portaobjetos de LabTek de ocho cámaras no se trataron (w / o) o se trataron con varios anticuerpos policlonales o monoclonales contra genes hCEA a una dilución 1: 4 durante 1 ha temperatura ambiente. Los anticuerpos se eliminaron y los cultivos se infectaron con V51B a una MOI de 5 durante 1 h. Se eliminó el inóculo de virus y se añadió a la cámara medio completo que contenía una dilución 1:20 del mismo anticuerpo. Se tomaron muestras de virus en los tiempos indicados y se determinaron los títulos de virus mediante ensayo de placa en células DBT-9. Figura 4. Expresión de la glicoproteína hCEA en células HepG2. Las células HepG2 se pretrataron con varios antisueros durante 30 min a temperatura ambiente. Después de un lavado extenso, se añadió antisuero IgG anti-ratón de conejo conjugado con FITC durante 30 min a temperatura ambiente. Después de un lavado adicional, las células se analizaron mediante técnicas FACS. (A) Col-1 (B) Col-12 (C) Col-14 (D) Col-6 (E) Kat4c.

Los virus persistentes reconocen las glucoproteínas de hCEA como receptores.

Figura 5. Los replicones pSinRep19 no inhiben la infección por MHV. Para determinar si los replicones pSinRep19 no citopáticos bloquean la replicación del MHV, se transfectaron cultivos de células BHK-MHVR con las transcripciones pSinRep19 / T7pol y se seleccionaron con puromicina (5 µg / ml) durante varios días. Los cultivos de células BHK-MHVR / SinT7pol, BHK-MHVR y BHK se infectaron con MHV-A59 a una MOI de 5 durante 1 h. Las muestras de virus se recogieron en los tiempos indicados y se analizaron mediante ensayo de placa en células DBT. Figura 6. Expresión de hCEA y hBgp en células BHK. Se transfectaron células BHK con transcripciones de los replicones pSinRep19-hBgp y pSinRep19-hCEA y se seleccionaron con puromicina (5 µg / ml) durante varios días. Utilizando el anticuerpo monoclonal Kat4c, los cultivos se clasificaron en líneas celulares BHK-hBgp1 (A), BHK-hBgp1 + (B) y BHK-hCEA (C). Estas líneas celulares se cultivaron en grandes reservas de líneas celulares que expresan niveles relativamente uniformes de hCEA o hBgp. El análisis FACS se realizó con el anticuerpo monoclonal Kat4c como se describió previamente (12). Figura 7. Replicación de MHV en células BHK que expresan glicoproteínas hCEA. Los cultivos de células BHK, BHK-hCEA, BHK-hBgp1 y BHK-hBgp1 + se infectaron con V51B o MHV-A59, como se indica, a una MOI de 5 durante 1 ha temperatura ambiente. En algunos experimentos, las células se habían pretratado con una dilución 1: 4 de pCEA o anticuerpo no específico EDDA durante 30 min antes de la infección. Después de la infección, los cultivos se lavaron extensamente y se tomaron muestras de virus en los tiempos indicados. Figura 8. Antígeno viral en células BHK que expresan glicoproteínas hCEA. Los cultivos tratados como se describe para la Fig. 7 se fijaron y se tiñeron con FA para detectar la presencia de antígeno viral. (A) Células BHK-hCEA infectadas con V51B (B) Células BHK infectadas con V51B (C) Células BHK-hCEA infectadas con MHV-A59 (D) Células BHK infectadas con MHV-A59. Figura 9. Replicación persistente del virus en células BHK-hCEA. Los cultivos de células BHK-hCEA (10 6) se infectaron con MHV-A59, V10B, V30B, V51A y V51B a una MOI de 5 durante 1 ha temperatura ambiente. Los títulos de virus se recogieron en los tiempos designados para el análisis mediante ensayo de placa.

Por qué los científicos modifican los virus de laboratorio para hacerlos más contagiosos

La caja de herramientas de microbiología incluye técnicas para inducir mutaciones en virus que otorgan a los microbios nuevos poderes. Los científicos realizan estas manipulaciones por muchas razones, incluido el deseo de comprender cómo los microbios evaden la detección por parte de nuestro sistema inmunológico. Pero agregar capacidad a un patógeno conlleva riesgos obvios, especialmente si esta "nueva función" implica una mayor virulencia o infecciosidad. Escapar de un laboratorio, por accidente o diseño, es una posibilidad. Entonces, ¿por qué hacerlo? Algunos investigadores argumentan que el trabajo puede ofrecer un vistazo a lo que puede hacer un virus antes de que ingrese al mundo natural y represente una amenaza para las personas.

La controversia sobre la investigación de la ganancia de función generó artículos académicos, conferencias e incluso una moratoria en 2014, cuando el gobierno de EE. UU. Suspendió la financiación durante tres años hasta que se pudieran tomar medidas para garantizar la seguridad del procedimiento. El debate sobre los experimentos de ganancia de función continúa en las últimas fases de la pandemia a medida que los pensamientos se vuelven hacia el & ldquonext one & rdquo o un posible segundo acto para COVID-19. Los responsables de la formulación de políticas científicas deben luchar por definir los raros casos en los que los beneficios de los experimentos que mejoran la capacidad de un virus para sobrevivir y prosperar en huéspedes humanos superan cualquier riesgo.

Densely technical discussions often bog down over the very definition of gain of function. Recently, semantics were front and center in the debate over whether National Institutes of Health&ndashfunded work at the Wuhan Institute of Virology (WIV) in China constituted gain-of-function research, a contention denied by the U.S. agency. The WIV has also been the focus of a revived dispute over whether SARS-CoV-2, the virus that causes COVID-19, escaped from its facility.

Here are a few basic answers to questions about why an obscure technical term now receives so much attention.

What is gain of function research?

Techniques to enhance some aspect of an organism&rsquos functioning are commonplace in research and applied to everything from mice to measles. One typical application of this approach is tweaking mouse genes to generate more of a protein that limits fat deposition.

But that is not the kind of gain-of-function study that raises fears among scientists and regulators. The high-risk practices are those that create mutations to examine whether a pathogen becomes more contagious or lethal as a means of estimating future threats.

Some experts acknowledge the critical differences between the two types of studies. One proposed term to represent the more threatening subset of this research is &ldquopotential pandemic pathogens,&rdquo says Marc Lipsitch, a professor of epidemiology at the Harvard T. H. Chan School of Public Health. That phrase &ldquosingles out the name and reason for being concerned,&rdquo he adds. It has not caught on in common usage, however, returning only about 8,500 results in a Google search, compared with 13.4 million for &ldquogain of function.&rdquo

Making this distinction is important for a few reasons, Lipsitch says. When the U.S. government placed the 2014 moratorium on &ldquogain of function research,&rdquo some of the studies that were affected carried no obvious risk of setting off a pandemic.

What is the purpose of this research?

Knowing what makes a microbe more dangerous enables preparation of countermeasures, says Lipsitch, who is one of 18 signatories to a May 14 letter, published in Ciencias, that calls for the investigation of a SARS-CoV-2 lab spillover as one of several possible explanations for the origins of the COVID-19 pandemic. He points to the difficulties of studying viruses for the development of vaccines and treatments without doing experiments in a mouse or in other nonhuman animals. There is, Lipsitch says, a &ldquodirect path from doing that research to gaining public health benefits,&rdquo enabling a balancing of risks and potential benefits.

The riskier version of gain-of-function research creates viruses with abilities they do not have in nature. In two separate studies in 2011, scientists famously and controversially did just that with the H5N1 influenza virus, or &ldquobird flu,&rdquo resulting in a version capable of airborne transmission among ferrets. The naturally occurring virus does not have this ability. Making mammal-to-mammal transmission easier set off alarm bells and triggered discussion of a U.S. moratorium.

In 2015 researchers engineered a hybrid pathogen that combined features of the original SARS virus (SARS-CoV) that infected humans in the early 2000s with that of a bat coronavirus. Most bat coronaviruses cannot infect the cells lining the human respiratory tract. This experiment was intended to mimic what would happen if a third species served as a mixing vat for the bat and human viruses to exchange genetic material. The result was a pathogen that could enter human cells and also cause disease in mice. Reactions to this work were polarized, as demonstrated by experts quoted in a 2015 article in Naturaleza: one said that all the research did was create a &ldquonew, non-natural risk&rdquo among the multitude that already exist, while another contended that it showed the potential for this bat virus to become a &ldquoclear and present danger.&rdquo

Experts in the latter camp argue that gain-of-function virus studies can presage what will eventually happen in nature. Speeding things up in the lab gives researchers firsthand evidence about how a virus might evolve. Such insights could drive predictions about future viral behaviors in order to stay a step ahead of these pathogens.

That calculation must be made on a case-by-case basis, Lipsitch says. &ldquoThere is not one-answer-fits-all,&rdquo he adds. But the key question to address in this complex computation is &ldquoIs this work so valuable for public health that it outshines the risk to public health in doing it?&rdquo

Lipsitch was &ldquovery outspoken,&rdquo as he puts it, about the influenza-ferret study, and he led the effort for the 2014 moratorium on similar gain-of-function work. &ldquoI did that because I thought that we need to have a real accounting of the benefits and risks,&rdquo he says. &ldquoI had a view that the benefits were very small, and I still have that view.&rdquo

The moratorium was lifted in 2017. A U.S. government review panel later approved a resumption of funding for more lab studies involving gain-of-function modifications of bird flu viruses in ferrets. Conditions of the approvals, according to reports, included enhanced safety measures and reporting requirements.

As for SARS-CoV-2, the virus of most urgent interest right now, the NIH released a statement on May 19 that neither the agency nor its National Institute of Allergy and Infectious Diseases has &ldquoever approved any grant that would have supported &lsquogain-of-function&rsquo research on coronaviruses that would have increased their transmissibility or lethality for humans.&rdquo

What are the risks?

Predictions based on gain-of-function studies may be hypothetical, but lab breaches in the U.S. are not. Serious violations are uncommon and have almost never resulted in a pathogen being released into the community. But 2014 showed why human error may prove to be the biggest wild card in planning these experiments.

Several lab accidents that year endangered researchers and set off waves of uneasiness. These incidents were not gain-of-function mishaps, but they demonstrated the potential threats posed by a biosafety lab&mdashwhether from negligence or malfeasance. In 2014 about 75 Atlanta-based employees at the U.S. Centers for Disease Control and Prevention learned about their potential exposure to anthrax after safety practices were ignored. Also, several long-forgotten vials of freeze-dried smallpox&mdasha pathogen long thought to be stored in only two places, one in Russia and one in the U.S.&mdashturned up during a cold-storage cleanup at the NIH that year. And the CDC made news again a month later, after it sent out vials of a relatively benign influenza virus contaminated with the much more deadly H5N1 avian flu virus. The possible reason, as reported in Ciencias, was that a researcher was &ldquooverworked and rushing to make a lab meeting.&rdquo

Michael Imperiale, a professor of microbiology and immunology and associate vice president for research and compliance at the University of Michigan, co-authored a 2020 editorial about gain-of-function studies that said that the key to planning them is to have proper mechanisms to ward off the threats of accidental or intentional harm. &ldquoIf proper biosafety procedures are in place and proper containment is used, the risks can be mitigated substantially,&rdquo he says. Biosafety level 4 (BSL-4) labs have the highest containment precautions in place, and the U.S. currently has 13 or more such facilities planned or in operation. Research on the novel coronavirus is handled in labs one notch down: BSL-3.

In their editorial, Imperiale and his co-author Arturo Casadevall, editor in chief of mBIO, wrote that even predicting the threat level of an accidental release is difficult. After publication of the studies of ferret-to-ferret transmission of engineered H5N1, two groups tried to predict what would have happened if this virus had escaped into the human population. One team, Imperiale and Casadevall wrote, predicted an &ldquoextremely high level&rdquo of transmission. The other, from one of the labs involved in the ferret-influenza work, concluded otherwise.

In the context of the COVID-19 pandemic, the authors of the editorial wrote, the source of a pathogen&mdashwhether from nature or a lab&mdashdoes not change how the world should prepare to respond to it. But gain-of-function experiments should be governed by transparency in planning the research, a &ldquorededication&rdquo to biosafety and a strong surveillance program to capture breaches.

What alternative techniques are available to test a potential viral threat?

If a virus has already moved from an animal host to humans, gain-of-function research may be unnecessary, Imperiale says. &ldquoIn these cases, there may be animal models that serve as useful surrogates for humans&rdquo in testing the virus&rsquos effects, he says.

Researchers can also test the capacity of virus proteins to engage with different kinds of cells. Software can predict how these proteins might interact with various cell types or how their genetic sequences could be associated with specific virus features. Also, if the researchers use cells in a lab dish, the viruses might be designed not to replicate.

Another option is loss-of-function research. Using versions of a virus with less pathogenic potential is another way to unlock that microbe&rsquos secrets. Still, highly pathogenic forms can be quite different from their less threatening counterparts&mdashfor example, they may differ in how often they replicate&mdashpossibly limiting the usefulness of such studies.


2 thoughts on &ldquoCross-Species Transmission in Rabies&rdquo

This was a really cool and informative post which clarified a lot of questions I had about CST. The fact that “the majority of viruses from cross-species infections were tightly nested among genetically similar bat species” paired with the statistics given makes me wonder how close human and bat defense systems really are.

Interesting study, though it might be overstepping its bounds in generalization. While this may have worked with bats infecting bats, I doubt that transmission between more dissimilar species, such as bats, pigs, or birds to humans, will factor host similarity to such a degree. For this reason, viral mutation still seems like the most plausible reason for cross-species transmission, though this finding may be much more applicable when applied to CST between more similar species, such as in this case.


Ver el vídeo: Přizpůsobení hostitele parazitům 2 (Junio 2022).


Comentarios:

  1. Pepe

    Y que haríamos sin tu magnífica idea

  2. Oded

    Confirmo. Todo lo anterior dijo la verdad.

  3. Gilley

    Sí, las mujeres atractivas distraen. Exactamente, cansado de los días críticos, ¡cambia de sexo! Título de la imagen divertida: “Ass. Vista frontal ”Siete niñeras tienen ... Catorce pechos, divertido, es correcto, no importa cuánto vodka tome, ¡todavía corres dos veces! (sabiduría). Se puso un ligero susto. ¿De qué es? Intereno que beba siete veces - ¡Bebe una vez! si se puede cambiar el lugar del enema. Las niñas carecen de feminidad y las mujeres carecen de virginidad. Este es exactamente el grupo escultórico: Hércules rasga la boca de un niño orina. Esta insignia genial en un progreso de HOM HA de 150 kilogramos hizo que los enchufes hicieron inaccesibles para la mayoría de los niños, el dado más talentoso. ))) La esposa de mi amiga no es una mujer para mí ... pero si ella es bonita. ... ... el no es mi amigo)))

  4. Kahla

    Creo que te equivocas. Estoy seguro. Hablemos de esto.



Escribe un mensaje