Información

¿Cómo afecta la inhibición de la topoisomerasa II a las células cancerosas?

¿Cómo afecta la inhibición de la topoisomerasa II a las células cancerosas?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Los venenos de topoisomerasa II representan algunos de los medicamentos contra el cáncer más importantes y ampliamente recetados actualmente en uso clínico. Estos medicamentos abarcan un grupo diverso de compuestos naturales y sintéticos que se usan comúnmente para tratar una variedad de neoplasias malignas humanas. En la actualidad, seis agentes contra el cáncer dirigidos a la topoisomerasa II están aprobados para su uso en los Estados Unidos y se recetan medicamentos adicionales en otras partes del mundo. Todos estos agentes actúan como venenos tradicionales de la topoisomerasa II y funcionan principalmente inhibiendo la ligadura del ADN mediada por enzimas.

Describe brevemente qué hace TopoII y cómo funciona. Explique qué significa "inhibir la ligadura de ADN mediada por enzimas".

Mi pensamiento para la primera pregunta es que las topoisomerasas de Tipo II cortan ambas hebras de la hélice de ADN simultáneamente para manejar los enredos y superenrollamientos del ADN. Utilizan la hidrólisis de ATP. Cambia el número de enlace de ADN circular en ± 2. Después de cortar los extremos, los extremos del ADN se separan y se pasa un segundo dúplex de ADN a través de la rotura. El ADN cortado se vuelve a ligar. Esto permite que la enzima aumente o disminuya el número de enlaces de un bucle de ADN en 2 unidades. También promueve el desenredo cromosómico. Inhibir la ligadura de ADN mediada por enzimas significa que evita que las enzimas no puedan ligarse. Esto se evita al no permitir la formación de un enlace fosfodiéster.

Las células cancerosas crecen mucho más rápidamente que la mayoría de las células del cuerpo. ¿Cuál sería la consecuencia de "inhibir la ligadura de ADN mediada por enzimas" y por qué esto podría ser particularmente perjudicial en las células cancerosas?

Realmente no estoy seguro de este.

He mirado las respuestas de Wikipedia a esta pregunta y están equivocadas.


Primera pregunta:

En general, las topoisomerasas son enzimas que alivian el superenrollamiento en las hebras de ADN y el enredo en los cromosomas. Las topoisomerasas de tipo II son especiales entre las topoisomerasas eucariotas, considerando que utilizan iones metálicos divalentes e hidrólisis de ATP en su sitio activo. La enzima corta ambas hebras de la hélice de ADN simultáneamente (rotura de la doble hebra) para gestionar los enredos y superenrollamientos del ADN. Cambia el número de enlace del ADN circular en ± 2. Después de cortar los extremos, los extremos del ADN se separan y se pasa un segundo dúplex de ADN a través de la rotura. El ADN cortado se vuelve a ligar. Esto permite que la enzima aumente o disminuya el número de enlaces de un bucle de ADN en 2 unidades. Inhibir la ligadura de ADN mediada por enzimas significa que evita que la enzima vuelva a ligar la hebra de ADN después de cortarla. En otras palabras, la prevención de un enlace fosfodeister entre nucleótidos.

Segunda pregunta:

En las células normales, la ADN topoisomerasa II desempeña varias funciones vitales, principalmente para aliviar los enredos y enrollamientos del ADN. Esto se hace generando "roturas transitorias de doble hebra" en la hebra de ADN, que a veces pueden causar translocaciones y daños dañinos. Los daños de este tipo están relacionados con ciertos tipos específicos de leucemia. Esta cualidad intrínsecamente "dañina" de la ADN topoisomerasa II puede aprovecharse en las células cancerosas debido a su alta tasa de replicación. Ciertos medicamentos contra el cáncer, como el etopósido, actúan alterando el sitio activo de la topoisomerasa II, evitando (inhibiendo) que la enzima ligue las moléculas de ADN escindidas, provocando roturas permanentes del ADN (e inhibiendo la replicación). La rápida tasa de replicación de las células cancerosas asegura que haya grandes cantidades de la enzima presente en la célula, lo que aumenta la eficacia de cualquier veneno de topoisomerasa II. Sin embargo, este fármaco también puede actuar contra algunos otros tipos de tejidos con grandes cantidades de topoisomerasa II, como el tejido cardíaco. Además, las células cancerosas están constantemente en un ciclo de crecimiento / replicación, por lo que exhiben grandes cantidades de la isoforma Topoisomerasa IIa, el tipo que es más probable que produzca roturas permanentes y perjudiciales del ADN.

Fuente:

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2647315/


¿Qué es la topoisomerasa?

Las ADN topoisomerasas son enzimas esenciales que controlan el estado topológico de la replicación del ADN durante la mitosis 1). Las enzimas ADN topoisomerasa se clasifican según sus mecanismos y propiedades físicas. Durante la mitosis, el ADN superhelical debe ser desenrollado o relajado por las ADN topoisomerasas antes de un paso de decodificación por las enzimas de procesamiento del ADN, como la ADN polimerasa y la ARN polimerasa. Al bloquear la reacción de volver a sellar las roturas en el ADN, en última instancia, puede resultar en la muerte celular. Los compuestos que inhiben la función catalítica de las enzimas ADN topoisomerasa representan dianas muy relevantes para el tratamiento de varios tipos de cáncer y las ADN topoisomerasas se encuentran bajo investigación continua como dianas para nuevas clases de agentes inhibidores. Si bien casi todos los inhibidores de la topoisomerasa comercializados clínicamente utilizados para tratar el cáncer pertenecen a la categoría mecanicista del veneno de la topoisomerasa, recientemente se han revelado varios inhibidores catalíticos muy prometedores y son prometedores como agentes anticancerosos potencialmente nuevos con perfiles de toxicidad significativamente reducidos. Cabe destacar las clases químicas novedosas con actividad contra las topoisomerasas de tipo I, ya que actualmente solo hay una clase comercializada de inhibidores de uso clínico.

Las ADN topoisomerasas son enzimas esenciales que controlan el estado topológico del ADN durante los procesos celulares tanto en células procariotas como eucariotas. Los procesos celulares incluyen la replicación, transcripción, recombinación y segregación de cromatina del ADN, para controlar la síntesis de proteínas y facilitar la replicación del ADN durante la mitosis 2). Todos los organismos contienen al menos dos clases de ADN topoisomerasas, a saber, ADN topoisomerasas de tipo I y tipo II, en las que las enzimas se clasifican en función de sus mecanismos y propiedades físicas. Por ejemplo, E. coli tiene dos ADN topoisomerasas de tipo I (ADN topoisomerasa I y ADN topoisomerasa III) y dos ADN topoisomerasas de tipo II (ADN topoisomerasa II o girasa y ADN topoisomerasa IV) 3). Los subtipos de ADN topoisomerasa (A, B o C) se diferencian por secuencias o estructuras de aminoácidos 4). Por ejemplo, las enzimas que escinden solo una hebra de ADN se definen como tipo I con una clasificación adicional de subtipos de tipo IA para proteínas vinculadas a un fosfato 5 'y subtipos de tipo IB para proteínas unidas a un fosfato 3' durante la relajación de el ADN escindible. Las enzimas se dividen además en subfamilias basándose en los cambios estructurales inducidos por la duplicación de genes, como la ADN topoisomerasa IIα y IIβ 5).

Los estudios en eucariotas han demostrado que la topoisomerasa de ADN de tipo I está asociada con genes transcritos activamente, mientras que la topoisomerasa de ADN de tipo II es necesaria para la replicación del ADN y el cruce exitoso de la mitosis 6). Las ADN topoisomerasas de tipo I y de tipo IIα son dianas bien conocidas para la quimioterapia de cánceres humanos avanzados o recurrentes.


Abstracto

Los datos recientes sugieren que la curcumina, un fitoquímico con potencial quimiopreventivo del cáncer, podría ser útil en el tratamiento de varias neoplasias malignas sólidas y hematológicas. Las ADN topoisomerasas (topos) son el objetivo de varios medicamentos que se usan comúnmente en la quimioterapia contra el cáncer. Estos fármacos inducen complejos de topo-ADN con topo I o topo II y luego el procesamiento celular convierte estos complejos en roturas permanentes de la cadena de ADN que desencadenan la muerte celular. Usando el ensayo in vivo de TARDIS, este estudio muestra por primera vez que la curcumina induce complejos de ADN topo I y topo II (α y β) -DNA en células de leucemia K562. Un análisis comparativo reveló que los niveles de estos complejos eran más altos que los inducidos por varios inhibidores estándar de topo I y topo II a dosis equitóxicas. Los complejos de topo I y topo II-ADN inducidos por la curcumina fueron prevenidos por el antioxidante norte-acetilcisteína, esto sugiere que, a diferencia de los inhibidores de topo estándar, las especies reactivas de oxígeno pueden mediar en la formación de estos complejos. En general, este trabajo muestra que la curcumina es capaz de inducir complejos de topo-ADN en células con topo I y topo II y aumenta la evidencia que sugiere que este agente dietético tiene potencial para ser probado en quimioterapia contra el cáncer.


Métodos

Poblacion de pacientes

Se recuperaron retrospectivamente los datos clínico-patológicos de pacientes que se remitieron para una cirugía de cáncer de mama al Centro Oncológico de la Universidad Sun Yat-Sen entre enero de 2007 y diciembre de 2009. Como resultado, se inscribieron 434 pacientes con cáncer de mama en estadio I-II, receptor hormonal positivo y negativo para HER2 confirmado patológicamente con datos completos y muestras de tumores primarios disponibles. El estadio de la enfermedad se redefinió de acuerdo con el sistema de estadios del American Joint Committee on Cancer (AJCC) para el cáncer de mama, séptima edición (2010). El receptor hormonal positivo se definió como ER y / o PgR positivo ≥10% por IHC HER2 negativo se definió como IHC 0-1 +, o IHC 2+, FISH negativo [22]. Los pacientes se clasificaron además en subgrupos Luminal A o B según las definiciones sustitutas basadas en IHC de acuerdo con el Consenso de St. Gallen 2013: luminal A: ER y PgR positivo, HER2 negativo y Ki-67 "bajo" (& lt 20%) luminal B (HER2−): ER positivo, HER2 negativo y al menos uno de: Ki-67 "alto" (≥20% ) o PgR negativo [11].

Expresión de la proteína TOP2A

La tinción TOP2A IHC se realizó en muestras tumorales incluidas en parafina fijadas con formalina utilizando un inmunotindor automático (BenchMark XT Ventana Medical Systems, Tucson, Arizona) de acuerdo con las instrucciones del fabricante. El anticuerpo primario utilizado fue el clon Ki-S1 (Gene Tech, Shanghai) a una dilución de 1: 100. Todas las muestras fueron examinadas y calificadas por dos patólogos independientes sin el conocimiento de los datos de los pacientes. Solo se consideró la tinción nuclear (la isoforma activa de TOP2A). Para cada muestra, se seleccionaron 5 campos microscópicos con un aumento de × 200 y se contaron 100 células tumorales en cada campo para evaluar la intensidad de la tinción (0, 1+, 2+, 3+) y el porcentaje de células positivas. La tasa de porcentaje positivo promedio se calculó como resultado final. La sobreexpresión de la proteína TOP2A se definió como ≥ 30% de células positivas.

Análisis estadístico

Los criterios de valoración primarios fueron la supervivencia libre de enfermedad (SSE), que se dividió a su vez en supervivencia libre de metástasis a distancia (CPOS) y supervivencia libre de recurrencia locorregional (LRFS), supervivencia específica del cáncer de mama (BCSS) y supervivencia general (SG). Las curvas de supervivencia se trazaron mediante el método de Kaplan-Meier y se compararon mediante la prueba de rango logarítmico. Se realizó un análisis de regresión de Cox multivariante para identificar variables independientes para la supervivencia. Las asociaciones entre la expresión de TOP2A y las características clínico-patológicas se evaluaron mediante la prueba de chi-cuadrado (variables de categoría) o la prueba t de dos muestras (variables continuas). Todas las pruebas estadísticas fueron de dos caras con PAG & lt 0,05 se consideró estadísticamente significativo.


Top1 controla la actividad de RNAPII en los loci de genes inducidos por PAMP

Para confirmar la especificidad de la actividad de Top1 en nuestro sistema, primero investigamos si la inhibición de genes inducidos por PAMP podría reproducirse utilizando un inhibidor de Top1 diferente. Por lo tanto, usamos topotecán (TPT), un inhibidor de Top1 aprobado por la FDA. Nuestros resultados indican que tanto la CPT como la TPT suprimen los genes inducidos por virus (Fig. 2A) pero no la entrada o replicación viral (Fig. S4). Esto fue respaldado además por la supresión genética inducida por PAMP observada en respuesta a la infección con el virus Sendai y el tratamiento con ácido poliinosínico-policitidílico [poli (I: C)] (figura S5). Reproducimos el efecto inhibidor de CPT y TPT sobre la expresión génica inducida por PAMP utilizando una línea celular diferente, el macrófago murino RAW 264.7 (fig. S6A). La inhibición de Top1 no suprimió la respuesta a otros estímulos como la señalización de estrógenos y el choque térmico, como lo indica el análisis de genes diana prototípicos (fig. S7, A y B, respectivamente).

(A) Expresión génica en células A549 humanas, sin tratar (-) o tratadas con CPT 0,5 µM, TPT 100 nM o DMSO, 4 horas después del tratamiento simulado o de la infección por el virus PR8ΔNS1. (B) Análisis de ChIP-qPCR de RNAPII endógeno y Top1 en los promotores de IFIT1, IFIT2 y ACTB en células A549 tratadas con 0.5 μM CPT o DMSO, 4 horas después del tratamiento simulado o de la infección por influenza PR8ΔNS1. (C) Metaplot de ChIP-seq de RNAPII endógeno en células A549 tratadas con CPT o DMSO 0,5 µM 6 horas después del tratamiento simulado o de la infección por el virus PR8ΔNS1. Los gráficos representan la ocupación de RNAPII en genes que muestran un factor de regulación positiva de 2 en su expresión después de la infección. (D) Pistas de ChIP-seq de genes antivirales representativos IFIT1 e IFIT2, y genes de mantenimiento ACTB y HPRT1. (mi) Representación esquemática de la síntesis química de TPT-A a partir de TPT. (F) Análisis de qPCR Chem-ChIP de la ocupación de TPT-A a través de los genes IFIT1, IFIT2, ACTB y HPRT1 en células A549 tratadas con DMSO o TPT-A 100 nM, 6 horas después del tratamiento simulado o la infección por PR8ΔNS1. *PAG & lt 0.05, **PAG & lt 0,005, ***PAG & lt 0,0005 (Estudiante t prueba con corrección secuencial de Holm-Bonferroni). Los datos son medias ± DE de tres (A) y dos [(B) y (F)] experimentos independientes.

Además, los experimentos de inhibición química y pérdida de función en células A549 indicaron que las enzimas topoisomerasas de clase II (Top2) no fenocopian completamente la actividad de Top1 durante la inducción de genes que responden a PAMP (fig. S8) junto con observaciones previas (29, 35, 36), este hallazgo sugiere que la inhibición de las topoisomerasas puede provocar efectos tanto específicos del gen como del tipo celular. En particular, y en línea con lo que otros han demostrado recientemente (29), ni las células tratadas con TPT ni con CPT mostraron daño en el ADN a la concentración que usamos (fig. S9).

Luego caracterizamos la distribución genómica de RNAPII y Top1 durante la infección en presencia y ausencia de inhibición de Top1. Nuestros resultados muestran niveles reducidos de promotor de RNAPII y Top1 en genes inducidos por PAMP en células A549 infectadas (figura 2B) y macrófagos (figura S6B) cuando se inhibe Top1. En particular, los niveles de RNAPII y Top1 en los genes de mantenimiento no se redujeron como resultado de la inhibición de Top1 (Fig. 2B y Fig. S6B), de acuerdo con su expresión génica no afectada (Fig. 2A y Fig. S6A). El direccionamiento reducido de RNAPII en loci inducidos por PAMP se confirmó mediante secuenciación de inmunoprecipitación de cromatina (ChIP-seq) (Fig. 2C) y mediante análisis de las pistas de RNAPII en genes inducidos por PAMP representativos y genes de mantenimiento (Fig. 2D).

Para vincular la causa (inhibición de Top1) y el efecto (niveles de RNAPII en los promotores), diseñamos una estrategia para mapear la distribución genómica de los inhibidores de Top1 a través de chem-ChIP, un método utilizado para revelar la localización genómica de fármacos (37). En resumen, primero sintetizamos un análogo de TPT (no tuvimos éxito con CPT), que es susceptible de acoplarse con un derivado de biotina. Este compuesto se denominó TPT-alquino (TPT-A Fig. 2E). La síntesis de TPT-A y la estrategia experimental se muestran en la fig. S10, A y B la validación de que TPT-A es tan eficaz como TPT se muestra en la fig. S10, C y D. Luego realizamos chem-ChIP y analizamos la distribución de TPT-A en la cromatina. En el estado basal, TPT-A se enriqueció en promotores y cuerpos génicos de genes activos como los genes ACTB y HPRT (Fig.2F), como se esperaba de los resultados que muestran que Top1 viaja con RNAPII alargado y que Top1 se distribuye a través del genoma (31, 38).

Durante la infección, la distribución de TPT-A alcanza un pico en los promotores de los genes inducibles IFIT1 e IFIT2 (Fig. 2F) pero no en los cuerpos génicos, lo que sugiere que la presencia del inhibidor no permite que RNAPII y Top1 entren en ciclos transcripcionales productivos. De hecho, la distribución de TPT-A se correlaciona inversamente con la densidad de RNAPII y Top1 solo en los promotores de genes inducidos por PAMP (Fig. 2B). Esto indica que la supresión de TPT-A de la actividad de Top1 conduce a una inhibición específica de la dirección de RNAPII en la mayoría de los loci que responden a PAMP (Fig. 2C). Estos resultados (i) corroboran la ausencia de un efecto de inhibición de Top1 en las amas de llaves, (ii) indican que tales genes pueden escapar de las consecuencias transcripcionales de la inhibición de Top1 (probablemente a través de Top2 fig. S8D), y (iii) designan un activador de RNAPII- como función para Top1 en loci inducidos por PAMP.


La inhibición de la topoisomerasa II suprime la proliferación de cánceres negativos a la telomerasa

El mantenimiento de los telómeros es necesario para la estabilidad de los cromosomas, y la telomerasa suele alargarlos después de la replicación del ADN. Tanto en las células tumorales como en las de levadura que carecen de telomerasa, los telómeros se mantienen mediante un mecanismo de recombinación alternativo. Estudios anteriores han indicado que la levadura Sgs1 y Top3 pueden trabajar juntas para eliminar superenrollamientos altamente negativos que se generan a partir de la recombinación. Sin embargo, el mecanismo por el cual las células erradican los superenrollamientos altamente positivos durante la recombinación sigue sin estar claro. En el presente estudio, demostramos que TOP2 está involucrado en la recombinación telómero-telómero. Perturbación de la estructura telomérica por RIF1 o RIF2 la deleción alivia el requisito de TOP2 en la recombinación telómero-telómero. En el alargamiento alternativo de las células teloméricas (ALT) negativas a la telomerasa humana, la caída de TOP2α o TOP2β disminuye los cuerpos de LMP asociados a ALT, aumenta los focos inducidos por la disfunción de los telómeros y desencadena el acortamiento de los telómeros. Se observaron resultados similares cuando se trataron células ALT con ICRF-193, un inhibidor de TOP2. Es importante destacar que el tratamiento con ICRF-193 bloquea los fenotipos asociados a ALT in vitro, provoca el acortamiento de los telómeros e inhibe la proliferación de células ALT en ratones. Tomados en conjunto, estos hallazgos implican que TOP2 está involucrado en la vía ALT, quizás resolviendo la estructura de superenrollamiento altamente positiva en el frente de la helicasa. La inhibición de la topoisomerasa II puede ser un enfoque terapéutico prometedor que puede usarse para prevenir la proliferación celular en células cancerosas de tipo ALT.

Esta es una vista previa del contenido de la suscripción, acceda a través de su institución.


Métodos

Síntesis química y reactivos

Se disolvieron en DMSO quinolina aminopurina 1 (QAP 1), análogo de purina biotinilado 2, análogos de purina 3 y 4 (la síntesis detallada se describirá en otra parte), 17-AAG e ICRF-193 (BIOMOL Research Laboratories Inc., Plymouth Meeting, PA) en DMSO. para producir una concentración final de 10 mM y se almacena a -20 ° C.Se disolvió doxorrubicina (BIOMOL Research Laboratories Inc., Plymouth Meeting, PA) en agua destilada para producir una concentración final de 10 mM y se almacenó a -20ºC. Todos los demás reactivos químicos fueron de calidad analítica. Todos los reactivos de cultivo celular se adquirieron de AMIMED (Allschwil, Suiza).

Producción de proteína alfa de topoisomerasa II humana marcada de longitud completa

Se clonó ADNc de la topoisomerasa II α humana en tres pasos sucesivos. Primero, la región 5 'del gen de la topoisomerasa II α corriente arriba del sitio EcoR1 se amplificó mediante PCR utilizando un clon ATCC (nº 59748) como molde y cebadores añadiendo un sitio Bgl2 en su extremo 5'. El producto de PCR purificado se digirió con Bgl2 y EcoR1 y se insertó en pFastBac1 (Invitrogen, Carlsbad, EE.UU.) previamente digerido con BamH1 y EcoR1. Luego, se insertó un fragmento EcoR1 / Pst1 del clon de la topoisomerasa II α ATCC en los sitios EcoR1 / Pst1 del plásmido obtenido previamente. Finalmente, el extremo 3 'de la topoisomerasa II α aguas abajo de Pst1 se amplificó mediante una PCR de dos pasos utilizando el clon ATCC como plantilla y cebadores añadiendo una etiqueta PreScission-His6-Strep y un sitio Sph1 en el extremo 3'. Este producto se digirió posteriormente con Pst1 y Sph1 y se insertó en los sitios correspondientes del plásmido obtenido previamente. La secuencia del gen insertado y las regiones flanqueantes se verificó mediante secuenciación de ADN. La proteína α de la topoisomerasa II se expresó en células Sf21 (Invitrogen, Carlsbad, EE.UU.) utilizando el sistema Baculovirus (multiplicidad de infección 2.0, 72 h de infección). El sedimento celular se resuspendió en 15 volúmenes de tampón de lisis enfriado con hielo (50 mM de Na2HPO4 pH 7,7, NaCl 500 mM, β-mercaptoetanol 10 mM, imidazol 5 mM, PMSF 100 μg / ml, MgCl 2 mM2 y cóctel inhibidor de proteasa sin EDTA (Roche Diagnostics GmbH)) y homogeneizado usando un homogeneizador Heidolph Diax 600. Después de la centrifugación durante 60 minutos a 48000 gy la filtración a través de un filtro Millipore de 3 μm, el lisado se cargó en una columna de afinidad HisTrap HP de 5 ml (GE Healthcare, Suecia), preequilibrada en tampón A (Tris-HCl 50 mM pH 8.0, NaCl 500 mM, β-mercaptoetanol 10 mM e imidazol 5 mM). La columna se lavó con tampón A que contenía imidazol 20 mM y la proteína se eluyó con un gradiente de tampón B (imidazol 250 mM en tampón A). Las fracciones combinadas que contenían proteína topoisomerasa II se cargaron en una columna de exclusión por tamaño SPX200 (16/20) equilibrada con Tris HCl 50 mM pH 7,7, NaCl 150 mM y DTT 2 mM, seguido de la carga en una columna StrepTactin de 10 ml (IBA, Alemania) equilibrado con Tris HCl 100 mM pH 8,0, NaCl 150 mM, β-mercaptoetanol 2 mM, EDTA 1 mM. Después de una breve etapa de lavado, la enzima se eluyó y se almacenó en Tris-HCl 100 mM pH 8,0, NaCl 150 mM, β-mercaptoetanol 2 mM, EDTA 1 mM y destiobiotina 2,5 mM. Se congelaron instantáneamente alícuotas de enzima de un solo uso en nitrógeno líquido y se almacenaron a -80 ° C hasta su uso.

Ensayo de ATPasa y análisis cinético

La hidrólisis de ATP dependiente de ADN de la topoisomerasa II α humana se controló midiendo la producción de fosfato inorgánico utilizando molibdato ácido y verde malaquita [45]. La actividad de ATPasa específica de cada lote se probó en un curso de tiempo para determinar los tiempos óptimos de incubación y las concentraciones de enzima dentro del rango lineal del ensayo. Por tanto, las reacciones contenían topoisomerasa II 10-40 nM (concentración de dímero) en tampón de reacción (Tris HCl 10 mM pH 7,5, KCl 175 mM, EDTA 0,1 mM, MgCl 5 mM2, DTT 2 mM, glicerol al 2,5% y pUC18 superenrollado 1,7 nM). La actividad específica de la enzima α de la topoisomerasa II humana medida en el ensayo de ATPasa fue de 0,24 μmol PO4· Min -1 · mg -1. Los compuestos se cribaron inicialmente a una concentración de 10 μM y IC50 se determinaron los valores si la inhibición era superior al 70%. Los compuestos a las concentraciones indicadas se añadieron como diluciones en serie preparadas en DMSO y se preincubaron durante 10 minutos a 37ºC en un agitador orbital. Las reacciones se iniciaron mediante la adición de ATP 400 µM (Sigma, número de catálogo A2383) y se dejaron continuar durante 30 minutos. Las reacciones se terminaron mediante la adición de 200 μl de reactivo de verde de malaquita y la DO se leyó inmediatamente a 630 nm en un lector de placas de microtitulación SpectraMax Plus utilizando el software SoftMax Pro (Molecular Devices). Para el análisis cinético, las reacciones se llevaron a cabo por duplicado como se describe anteriormente, ya sea en presencia de vehículo (DMSO) o QAP 1. Después de una preincubación durante 5 minutos, se añadió ATP a las concentraciones indicadas para iniciar las reacciones, que se dejaron continuar. durante 17 minutos antes de detenerse y leer como se indicó anteriormente. De estos valores, los valores de DO obtenidos en cada concentración de ATP respectiva sin enzima se restaron para la corrección de fondo. La baja relación señal / ruido del ensayo de verde de malaquita no permitió el estudio de una amplia gama de concentraciones de inhibidor en experimentos de competición. Las concentraciones bajas de inhibidor no dieron como resultado una inhibición suficiente para demostrar claramente el efecto del inhibidor y las concentraciones de inhibidor más altas dieron señales muy débiles. Se encontró un compromiso al llevar a cabo los experimentos de competencia con una sola concentración del inhibidor que dio una buena inhibición de la actividad enzimática mientras se mantenía una señal medible. Las ecuaciones utilizadas para ajustar estos experimentos son:

Cada experimento de competición se ajustó (Grafit versión 5.04 - Erithacus Software) con estas 3 ecuaciones y se rechazaron los modelos que daban constantes de inhibición poco realistas (por encima de 10 mM) y / o grandes errores estándar (similares al valor del parámetro ajustado). Luego, se llevó a cabo la prueba F para identificar el modelo de mejor ajuste. Se utilizó un método alternativo para determinar el modo de acción del inhibidor. Los experimentos de dosis-respuesta se llevaron a cabo a diferentes concentraciones de ATP y el IC correspondiente50s determinado. Según la ecuación de Cheng-Prusoff para la inhibición competitiva lineal [25]:

El IC50 de un inhibidor inhibidor competitivo debería aumentar de forma lineal con la concentración de ATP. El IC medido50A continuación, se representaron gráficamente en función de las concentraciones de ATP y se llevaron a cabo análisis de regresión lineal. Para el cálculo de los parámetros cinéticos de Michaelis-Menten [46], los datos se trazaron en XLfit 4 (software de ajuste de curvas XLfit 4 para Microsoft Excel, ID Business Solutions Ltd, Guildford, Surrey, Reino Unido) y se linealizaron de acuerdo con Eadie-Hofstee. En el último gráfico, se omitieron los puntos de datos obtenidos a la concentración de ATP más baja, ya que son los más propensos a errores. Media Kmetro y Vmax Los valores se calcularon a partir de dos experimentos independientes.

Ensayo de decantación de ADN

Los reactivos para el ensayo se compraron a TopoGEN (número de catálogo 1001-1, TopoGEN, Inc., Port Orange, FL). La topoisomerasa II se extrajo de acuerdo con las instrucciones del fabricante a partir de núcleos de células HL-60 (ATCC American Type Culture Collection, Manassas, Virginia, EE. UU.) Y contenía ambas isoformas evaluadas mediante Western Blot. El cálculo de la actividad de decantación de la topoisomerasa II específica se basó en la decadenación completa de una cantidad determinada de ADN de entrada catenado (100 ng kADN) mediante una cantidad definida de extracto nuclear que contiene las isoformas alfa y beta o de una cantidad definida de enzima purificada en una cantidad determinada de tiempo. La actividad de la topoisomerasa II de los núcleos decatenó 0,07 ng de kDNA catenado · min -1 · ng -1 de extracto. La topoisomerasa II alfa purificada (véase más arriba) decatenó 0,13 ng de kDNA catenado · min -1 · ng -1. Se añadió vehículo (DMSO) o sustancia farmacológica a concentraciones para producir las concentraciones finales deseadas y las muestras se preincubaron durante 5 minutos a 37ºC y 400 rpm en un termomezclador Eppendorf. Las reacciones se iniciaron añadiendo ATP (a una concentración final de 450 µM) a cada muestra y se continuó la incubación durante 20 minutos. Las reacciones se terminaron colocando las muestras en hielo y añadiendo 4 µl de tampón de carga de parada / gel. Se separaron 20 µl de cada muestra mediante electroforesis en gel de agarosa al 1%. Los geles se analizaron con un transiluminador UV y los productos de kDNA decatenados se cuantificaron utilizando el software de análisis de imágenes AlphaEaseFC (FluorChem 8900) versión 3.2.3 (Alpha Innotech, San Leandro, CA).

Precipitación de afinidad

La topoisomerasa II α y β se precipitaron por afinidad con inhibidor biotinilado como sigue. Las células HL-60 en crecimiento exponencial se recogieron en hielo y se incubaron con tampón hipotónico (HEPES 10 mM pH 7,5, MgCl 1,5 mM2, KCl 10 mM, DTT 0,5 mM, PMSF 0,5 mM, cóctel inhibidor de proteasa 1x (Complete Mini, Roche Diagnostics GmbH)) durante 15 minutos, luego se añadió NP-40 al 0,6% v / v y las células se rompieron usando un homogeneizador Dounce . Los lisados ​​se transfirieron a tubos Protein LoBind Eppendorf de 1,5 ml y los núcleos se recogieron después de centrifugar a 8000 rpm durante 10 minutos y se lavaron dos veces con tampón hipotónico. Para extraer y liberar la topoisomerasa II asociada a la cromatina, los núcleos se incubaron durante 30 minutos en tampón de ADNsa (Tris HCl 20 mM, pH 7,5, MgCl 5 mM2, CaCl 1 mM2, NaCl 25 mM, EDTA 0,5 mM, NP-40 al 1%, DTT 1 mM, cóctel inhibidor de proteasa 1 ×, PMSF 0,1 mM) que contiene 40 U de ADNasa I (Roche Diagnostics GmbH) seguido de la adición de tampón de extracción nuclear dos veces concentrado (20 HEPES mM pH 7,5, MgCl 3 mM2, KCl 20 mM, β-glicerofosfato 50 mM, NaCl 840 mM, EDTA 1 mM, PNPP 50 mM, DTT 1 mM, PMSF 1 mM) y rotación durante 1 h en la cámara frigorífica. La fracción soluble se obtuvo tras centrifugación a 13000 rpm durante 15 minutos. Se utilizaron 25 µg de extracto nuclear para la precipitación por afinidad. La concentración de sal se ajustó a 150 mM con tampón de extracción nuclear (sin NaCl) y el volumen de la muestra se completó hasta 200 μl con tampón de precipitación (HEPES 50 mM pH 7,4, NaCl 150 mM, β-glicerofosfato 25 mM, NaF 25 mM, EGTA 5 mM, EDTA 1 mM, PPI 15 mM, PMSF 1 mM). Los compuestos se preincubaron durante 30 minutos antes de la adición del análogo 2 de purina biotinilado durante 2 h. Las perlas de estreptavidina agarosa (Novagen, 69203) se lavaron dos veces con PBS, se bloquearon durante 30 minutos con PBS que contenía BSA al 1%, se lavaron dos veces con PBS y finalmente con tampón de precipitación. Se añadieron a la muestra 40 µl de perlas de agarosa de estreptavidina equilibradas y se continuó la incubación durante 1 h. Las perlas se sedimentaron mediante centrifugación a 7000 rpm durante 5 minutos y se lavaron tres veces con tampón de precipitación. Durante el último lavado, las perlas se transfirieron a un tubo nuevo y la fracción unida se liberó hirviéndola durante 5 minutos en tampón de muestra Laemmli. La topoisomerasa II α y β se detectaron mediante transferencia Western como se describe a continuación.

ARNip α y β de topoisomerasa II

Se sembraron 0,3 x 106 células HeLa T-Rex (Invitrogen, Paisley, Reino Unido, Reino Unido) por placa de 6 cm en 2,6 ml de medio sin antibióticos. El día después de la siembra, las células se transfectaron durante 72 horas con oligos de ARN sigilosos (Invitrogen, Paisley, Reino Unido, Reino Unido): oligo de control sigiloso 1: 5'ACUUCCGAUUCGUGUAACCGAC UUU3 'y oligo de control sigiloso 2: 5'GGGCUA GUUAUAGUCGACACUGGUA3') o con Oligos de ARN dirigidos contra los transcritos α y β de la topoisomerasa II (α1: 5'ACUCAGCCUCUUAUGUGCCAAGUUU3 'α2: GGACAACAUUUG AUCCAAGAUCUUA3' y β1: 5'GGGUGAUCUUGAUACUGCAGCAGUA3 '). Se usó Lipofectamine ™ 2000 para transfectar oligos de acuerdo con las instrucciones del fabricante. El medio que contenía lipofectamina se reemplazó 6 horas después de la transfección por 3 ml de medio de cultivo fresco. Las células se extrajeron en 200 μl de tampón de lisis (Tris-HCl 50 mM, pH 7,5 EDTA 5 mM NaCl 420 mM 0,5% Nonidet P-40 (NP-40) Benzamidina 1 mM NaF 20 mM y MgCl 1,5 mM2) recién suplementado con PMSF 1 mM (de una solución madre 100 mM en etanol), DTT 1 mM (de una solución madre 1 M) y cóctel inhibidor de proteasa 1 x. Los lisados ​​se centrifugaron a velocidad máxima en una centrífuga Eppendorf durante 10 minutos a 4 ° C. El sedimento nuclear se resuspendió en 22 μl de tampón de muestra Laemmli y se hirvió a 95 ° C durante 5 minutos. Se sometieron 15 μl de extractos nucleares a SDS-PAGE desnaturalizante al 6%, se transfirieron a membranas de PVDF y se sondaron con el anticuerpo anti-topoisomerasa II β (sc-13059, Santa Cruz Biotechnology, Santa Cruz, CA diluido 1: 1000 en PBS 0.1% Tween) usando un anticuerpo secundario apropiado y quimioluminiscencia mejorada (ECL, Amersham Pharmacia Biotech Inc., Buckinghamshire, Reino Unido). Después de quitar la membrana, se volvió a sondar con un anticuerpo de cabra anti-topoisomerasa II α (sc-5348, Santa Cruz Biotechnology, Santa Cruz, CA diluido 1: 2000 en PBS 0.1% Tween). Las bandas inmunorreactivas se revelaron mediante proteína G conjugada con HRP (Zymed, CA diluido 1: 3000 en PBS Tween al 0,1%) usando reactivos ECL.

Ensayo gamma-H2AX

Se prepararon extractos de histonas de células HL-60 o HeLa T-Rex para análisis de transferencia Western como sigue: Después de los tratamientos, se eliminó el medio y las células se recogieron / lavaron con PBS. Las células se centrifugaron durante 5 minutos a 1500 rpm y 4ºC y el sedimento celular se resuspendió en 300 µl de tampón hipotónico enfriado con hielo (ver más arriba). Las células se transfirieron a un tubo Eppendorf de 1,5 ml y se incubaron durante 15 minutos en hielo. Posteriormente, se añadió NP-40 a las células a una concentración final de 0,6% (v / v) y las células se rompieron bombeando de 10 a 15 veces a través de una jeringa de 1 ml conectada a una aguja de calibre 23. El extracto se centrifugó durante 10 minutos a 8000 rpm y 4 ° C. Se eliminó el sobrenadante (fracción citoplásmica) y el sedimento nuclear se lavó una vez con 500 µl de tampón hipotónico helado durante 4 minutos a 8000 rpm. Las proteínas nucleares se extrajeron mediante la adición de 22 µl de tampón de muestra y se hirvieron durante 3 minutos. Las muestras se resolvieron mediante SDS-PAGE al 15% después de la transferencia a una membrana de PVDF. Después del bloqueo, las membranas se incubaron con anti-γH2AX (clon JBW301, 05-636, Upstate, Charlottesville, VA, diluido 1: 1000 en PBS que contenía Tween 20 al 0,1% y leche al 5%) o histona H3 (número de catálogo 9715, Cell Signaling Technologies Inc., Beverly, MA, diluyó 1: 1000 en TBS que contenía anticuerpos Tween 20 al 0,1% y leche al 5%) durante la noche a 4ºC. Los correspondientes anticuerpos secundarios conjugados con peroxidasa de rábano picante se diluyeron 1: 3000 y se incubaron durante 1 hora a temperatura ambiente y se revelaron bandas inmunorreactivas como se describió anteriormente.

El análisis In-Cell Western se llevó a cabo como sigue. Se sembraron células HeLa T-Rex a la densidad celular de 15 x 103 células por pocillo en placas negras de 96 pocillos (Greiner Bio-one Vacuette, St Gallen, Suiza). El día posterior a la siembra, las células se pretrataron con concentraciones crecientes de ICRF-193, QAP 1 o vehículo (DMSO) durante 30 minutos, seguido de un tratamiento de 2 horas con 1 μM de doxorrubicina, o solo se trataron con las mismas concentraciones de ICRF. -193, QAP 1 o vehículo (DMSO) durante 2 horas. Los tratamientos se realizaron por triplicado. Las células se fijaron directamente mediante la adición de 100 µl de formaldehído al 3,7% (diluido 1:10 en PBS de una solución de formaldehído al 37% Sigma, Buchs, Suiza) por pocillo durante 10 minutos a temperatura ambiente. Las membranas celulares se permeabilizaron mediante 4 lavados con 100 µl por pocillo de PBS que contenía Tween-20 al 0,25% durante 4 minutos. Las células se bloquearon con 50 µl por pocillo de tampón de bloqueo Odyssey (OBB LI-COR Biosciences GmbH, Bad Homburg, Alemania) durante 2 horas a temperatura ambiente con agitación suave. Se incubaron 25 μl por pocillo de anticuerpo γH2AX (clon JBW301, número de catálogo 05-636, Upstate, NY) diluido 1: 500 en OBB durante la noche a temperatura ambiente con agitación suave. Las células se lavaron 5 veces con 50 μl por pocillo de PBS que contenía 0,1% de Tween-20 durante 3 minutos y se tiñeron con 25 μl por pocillo de anticuerpo de cabra anti-ratón InfraRedDye 800 (Rocklands Immunochemicals, Inc., Gilbertsville, PA) diluido 1: 800 en OBB que contiene 0,2% de Tween-20 durante 1 hora a temperatura ambiente en la oscuridad. Se realizó un lavado adicional con 50 μl por pocillo de PBS que contenía 0,1% de Tween-20 antes de la tinción del ADN con 50 μl por pocillo de yoduro TO-PRO-3 (642/661) (Invitrogen AG, Basilea, Suiza) diluido 1: 5000 en OBB durante 1 hora a temperatura ambiente en la oscuridad. Finalmente, las células se lavaron 4 veces con 50 μl por pocillo de PBS que contenía 0,1% de Tween-20 durante 3 minutos, se retiró el líquido y las placas se mantuvieron a 4 ° C hasta la lectura. Las señales de γH2AX se leyeron utilizando el generador de imágenes por infrarrojos LI-COR Odyssey con el software Odyssey v1.1 utilizando el canal de 800 nm. Los valores en blanco corresponden a la señal de γH2AX no específica detectada en pocillos sin tinción de anticuerpo primario. Las medias de estos valores se restaron de las señales de γH2AX para corregir el fondo no específico. Los valores resultantes para cada muestra se normalizaron a la cantidad de ADN midiendo las correspondientes señales de yoduro de TO-PRO-3. Las señales de yodo TO-PRO-3 se detectaron utilizando el canal de 700 nm. El porcentaje de señal de γH2AX se determinó para cada concentración de ICRF193 y QAP 1 con o sin tratamiento con doxorrubicina estableciendo el valor para el tratamiento con vehículo y doxorrubicina 1 µM al 100%. Para mostrar la supresión relativa de la inducción de γH2AX y la inhibición de la topoisomerasa II catalítica en las células, los valores medidos en presencia de inhibidor catalítico se restaron del valor correspondiente medido a la misma concentración de inhibidor catalítico pero en presencia de doxorrubicina 1 µM. Estos datos se trazaron en XLfit 4 (software de ajuste de curvas XLfit 4 para Microsoft Excel, ID Business Solutions Ltd, Guildford, Surrey, Reino Unido) para determinar el IC50 valores de los inhibidores catalíticos de la topoisomerasa II mediante cálculo logístico de cuatro parámetros.

Ensayo de segregación cromosómica

Las células HL-60 se trataron durante la noche durante 16 horas con 2 µg / ml de afidicolina (Sigma-Aldrich Corporation, St. Louis, MO) y se liberaron lavando dos veces con PBS y resuspendiendo en medio fresco. Después de 6 horas de liberación, las células se trataron con cafeína 1 mM (Lancaster Synthesis, Heysham, Lancashire, Reino Unido) y con inhibidor catalítico de topoisomerasa II o vehículo durante 2 horas. Las células se lavaron una vez con PBS y se incubaron con una solución hipotónica de KCl 56 mM durante 30 minutos. Las células se sedimentaron y se resuspendieron cuidadosamente en fijador de Carnoy. Las células se sedimentaron como antes, se eliminó el sobrenadante y las células se resuspendieron de nuevo en 2 ml de fijador. Se prepararon extensiones de cromosomas dejando caer 50 µl de suspensión celular en portaobjetos de microscopía.Los portaobjetos se dejaron secar y luego se tiñeron durante 10 segundos con colorante Hoechst 33342 (Molecular Probes, Eugene, Oregon, preparado 1: 1000 en PBS a partir de 10 mg / ml de reserva). Después del secado, se agregaron los medios de montaje (Vectashield®, Vector Laboratories, Burlingame, CA) y un cubreobjetos. Las muestras se observaron utilizando una lente de aceite de inmersión (100x, Nikon, Plan Apo VC) mediante microscopía de fluorescencia (Nikon Eclipse, E600) en el canal DAPI. Las imágenes se adquirieron utilizando el software analySIS® (Soft Imaging System GmbH, Münster, Alemania). Las imágenes representativas se convirtieron a escala de grises, se invirtieron y se ajustaron el contraste con Adobe Photoshop. Las células mitóticas se clasificaron como se describe [47].

Ensayo de crecimiento clonogénico con células HCC1937

Se cultivaron células de carcinoma ductal de mama HCC1937 BRCA1 mutantes y HCC1937 BRCA1 reconstituidas en medio RPMI-1640 complementado con suero de ternero fetal al 10%, L-glutamina 2 mM, piruvato sódico 1 mM, 4,5 g / l de glucosa y 1% (v / v) penicilina / estreptomicina. El estado de BRCA1 se corroboró mediante inmunoprecipitación utilizando 50 μg de extractos nucleares y 1 μg de anticuerpo monoclonal de ratón MS110 (ab16780, Abcam Inc., Cambridge, MA), que se dirige hacia el extremo amino de la proteína. Las transferencias se sondaron con el anticuerpo monoclonal de ratón específico del extremo carboxi BRCA1 D9 (sc-6954, Santa Cruz Biotechnologies, Santa Cruz, CA) y, después de la separación, se volvieron a sondar con el anticuerpo MS110. Para los ensayos, se sembraron 5000 células en 3 ml de medio por pocillo de placas de 6 pocillos por duplicado. Al día siguiente, se agregaron vehículo (DMSO) o compuestos. Después de una semana, se cambió el medio y se volvieron a agregar el vehículo o los compuestos durante dos días más. Para evaluar la proliferación, el medio en cada pocillo se reemplazó con 1 ml de medio que contenía 100 μl de reactivo WST-1 y se incubó durante 20 minutos a 37 ° C. De cada muestra, se transfirieron 110 µl de sobrenadante a una placa de 96 pocillos y se leyó la DO a 450 nm (filtro a 630 nm) en un lector de placas de microtitulación SpectraMax Plus usando el software SoftMax Pro (Molecular Devices). Para la corrección de fondo, el valor en blanco consistió en 100 µl de medio que contenía 10 µl de WST-1. Posteriormente, las colonias se tiñeron eliminando el medio, lavando las células una vez con PBS e incubando con 1 ml de solución de violeta cristal durante 30 minutos a temperatura ambiente. Las células se lavaron dos veces con PBS y las colonias se contaron usando un contador Artec (Modelo 880, Artec, Dyntatech Laboratories Inc.) con un límite de diámetro establecido en 0,2 mm. Los datos se expresaron como crecimiento o número de colonias en relación con los tratamientos de control con vehículo (100%).


Información de soporte

Figura S1. Análisis de la organización del centrómero después del agotamiento de TOPO II. Inmunolocalización de CID en células S2 tratadas con choque hipotónico antes de la fijación celular con dos puntos CID por cromosoma (canal individual a la derecha).

(B) En las células empobrecidas en TOPO II, los cromosomas se observan como grupos más grandes de cromátidas con cromatina interconectada y tinción CID amplia en la constricción primaria (canal individual a la derecha).

Se utilizó la hibridación fluorescente in situ con ADN dodeca-satélite, una secuencia pericentromérica heterocromática, para identificar específicamente el cromosoma 3 en las células (C) control o (D – F) TOPO II empobrecidas.

(C) En las células de control, observamos dos regiones de hibridación por cromosoma claramente definidas que se localizan cerca de la constricción primaria.

(D) En las células agotadas en TOPO II a las 96 h, varios cromosomas (60%, norte = 60) exhiben cuatro regiones de hibridación dodeca-satélite, lo que sugiere que corresponden a diplocromosomas.

(E y F) En las células empobrecidas en TOPO II, también se pueden observar grupos más grandes de cromosomas homólogos.

(G – I) También se realizó hibridación fluorescente in situ con ADN dodeca-satélite (canal verde y blanco separado) en células asincrónicas, tanto en células control (G) como en células empobrecidas en TOPO II (H e I). En la placa de metafase, los cromosomas se pueden observar individualmente en las células de control (G) o en las células empobrecidas de TOPO II (H). Sin embargo, en la anafase, los centrómeros no separados se observan sólo en las células empobrecidas en TOPO II (I). La mayor parte de la cromatina se segrega como cromátidas no separadas, aunque también se pueden observar algunos diplocromosomas.

(J) Se realizó una transferencia de Southern para el ADN genómico de las células S2 de control y las células empobrecidas en TOPO II 96 h después de la adición de dsRNA. El ADN ribosómico (ADNr), una secuencia heterocromática que se localiza específicamente en la región proximal del centrómero X, se utilizó como sonda y también Zw10, un solo gen también del cromosoma X. Zw10 se utilizó como control interno para normalizar el número de cromosomas X. La intensidad de las bandas de ZW10 y rDNA se determinó midiendo la intensidad media de píxeles. La relación de las intensidades obtenidas para el gen y la secuencia de ADNr es la misma para el ADN genómico extraído de las células de control y de células empobrecidas en TOPO II. Este resultado indica que la replicación del ADNr ocurre en la misma proporción que los genes eucromáticos, lo que sugiere que la replicación de la heterocromatina no se ve afectada específicamente en ausencia de TOPO II. La barra de escala representa 5 μm.

Figura S2. Interacción microtúbulo-cinetocoro en células empobrecidas con TOPO II

(A y B) Inmunofluorescencia para α-tubulina (verde), CID (rojo) y ADN (azul) en (A) control y (B) células empobrecidas en TOPO II sometidas al ensayo MG132-Taxol.

(C) La cuantificación muestra que algunos cromosomas (≤3% de control, norte = 35 células TOPO II dsRNAi, norte = 38 células), ya sea en el control o las células empobrecidas en TOPO II tienen cromosomas monoorientados, mientras que la mayoría muestra unión sintélica. No se obtuvieron diferencias entre el control y las células empobrecidas en TOPO II durante el transcurso del tiempo del experimento.

(D) Curiosamente, en los husos que aún no se han colapsado, pudimos observar puentes de cromatina entre los cromosomas, lo que sugiere la presencia de ADN catenado entre los cromosomas. La barra de escala representa 5 μm.

Figura S3. Cuantificación de la distancia del centrómero hermano durante la progresión a través de la mitosis en células empobrecidas en TOPO II

(A) Imágenes de la grabación de lapso de tiempo de células S2 que expresan de manera estable el marcador centrómero CID-mCherry (canal rojo e individual a la derecha) y GFP-α-tubulina. Z-se recolectaron pilas tanto en células de control como en células empobrecidas en TOPO II.

(B) La cuantificación de la distancia del centrómero hermano no muestra ninguna diferencia entre el control (norte = 70) y células empobrecidas en TOPO II a las 96 h (norte = 60) durante la profase.

(C) Cuantificación de la distancia del centrómero hermano durante la prometafase, metafase y anafase de (D) imágenes de lapso de tiempo de S2 que expresa CID-GFP e histona RFP-H2B. El gráfico (C) muestra que mientras que en las células de control, la distancia entre los centros aumenta continuamente, en las células con agotamiento de TOPO II, la distancia entre los centros nunca cambia incluso cuando se compara con las células en profase (ver [B]). La barra de escala representa 5 μm.

Figura S4. Caracterización de la salida mitótica después del agotamiento de TOPO II y RAD21

La progresión a través de la mitosis se determinó utilizando ciclina B para determinar claramente la salida de la mitosis y también las etapas más tempranas, como la prometafase (72 h de tratamiento). Se inmunoteñieron células (A) de control o (B) TOPO II– y células empobrecidas en DRAD21 para ciclina B (verde), CID (rojo) y ADN (azul). El retraso de la cromatina se observa en la anafase tardía de las células con doble empobrecimiento. La barra de escala representa 5 μm.

Figura S5. Análisis in vivo de la progresión mitótica después del agotamiento de RAD21 en las células S2

(A y B) La progresión a través de la mitosis se determinó utilizando ciclina B (rojo) y α-tubulina y ADN (azul) para (A) control o (B) células empobrecidas en RAD21. La barra de escala representa 5 μm. (B) Las células empobrecidas en RAD21 presentan un retraso en la mitosis y presentan cromátidas hermanas separadas.

(C) La cuantificación del índice mitótico no muestra diferencias significativas entre las células de control y las células empobrecidas en TOPO II durante el transcurso del tiempo del experimento. Aunque cuantificamos un retraso en una etapa similar a la prometafase con cromátidas hermanas separadas, el porcentaje de células mitóticas no aumentó durante el tiempo de agotamiento.

(D) La inmunolocalización de RAD21 (blanco, canal izquierdo separado), SMC4 (rojo), TOPO II (verde) y ADN (blanco, canal derecho separado) en células mitóticas S2 tratadas con choque hipotónico se realizó en control o sin RAD21 células. En las células empobrecidas en RAD21, las cromátidas hermanas permanecen una al lado de la otra, aunque no se detecta la proteína cohesina.

(E) Imágenes de videos de células S2 que progresan a través de la mitosis después del agotamiento de RAD21 (Video S12). Células S2 empobrecidas en RAD21 que expresan de manera estable el marcador centrómero CID-GFP y la histona RFP-H2B. Para las células empobrecidas en RAD21, se registraron diez células a las 72 h de agotamiento. Los cromosomas no se alinean en la placa de metafase y observamos un movimiento limitado de cromosomas / cromátidas hermanas durante la mitosis. Finalmente, las células salen de la mitosis después de un largo período. La barra de escala representa 5 μm.

Figura S6. Caracterización de la salida mitótica de células empobrecidas en TOPO II

(A y B) Inmunolocalización de ciclina B y CID en (A) control o (B) células empobrecidas en TOPO II. Tanto en el control como en las células empobrecidas en TOPO II, la ciclina B se localiza en el huso, los centrómeros y los polos durante la prometafase y la metafase. Durante la anafase, el nivel general de ciclina B cae y es casi indetectable por telofase. La tinción con ciclina B se utilizó para confirmar que en ausencia de TOPO II, las células mitóticas que exhibían puentes o cromatina retrasada estaban de hecho en anafase, ya que exhibían niveles bajos de ciclina B.

(C) La progresión mitótica se determinó mediante inmunolocalización con ciclina B, tanto a las 72 h como a las 96 h después de la adición de dsRNA. En comparación con las células de control, se detectó un aumento en las células empobrecidas de TOPO II en prometafase, que es paralelo a una disminución en el porcentaje de células en metafase. La barra de escala representa 5 μm.

Figura S7. Inmunolocalización de PH3 y TOPO II en células tratadas con ICRF-187

(A) Células de control y (B) tratadas durante 2 h con ICRF-187 10 μM, después de lo cual se inmunoteñieron para Phospho-S10-histone H3 (verde) y para TOPO II (azul). TOPO II y PH3 se localizaron en los cromosomas tanto en las células de control como en las tratadas, aunque se detectó una reducción en los niveles de PH3.

(C) Los niveles de fosfo-S10-histona H3 se cuantificaron tanto en el control (norte = 25) y en células tratadas con ICRF-187 (norte = 20). Las imágenes se recogieron en las mismas condiciones y se determinó la intensidad media de píxeles. La reducción del 45% observada en las células tratadas es significativa por el Student t prueba (pag & lt 0,005). La barra de escala representa 5 μm.

Video S1. Microscopía confocal de lapso de tiempo de células S2 que expresan de manera estable CID-GFP y RFP-H2B

Z-Las pilas se adquirieron cada 30 s (el tiempo se muestra en segundos). Cada pila Z es de 10 μm y está compuesta por diez secciones ópticas. El inicio de la anafase corresponde al tiempo 0 s. Las imágenes en color de fusión de los canales RFP-H2B (rojo) y CID-GFP (verde) se muestran a la izquierda. El canal CID-GFP (blanco) se muestra solo a la derecha. Los dos pares CID-GFP de cada centrómero fueron identificados y etiquetados en cada capa que componen el Z-apila en los diferentes puntos de tiempo. La distancia media entre los puntos CID-GFP es de aproximadamente 1 μm. El seguimiento de los pares de cinetocoros se realizó mediante un complemento para el software Image J. El video de cada par CID-GFP está etiquetado con el mismo color.

Video S2. Microscopía de lapso de tiempo de células S2 que expresan de manera estable CID-GFP y RFP-H2B y empobrecidas para TOPO II, 72 h después de la adición del dsRNA

Z-Las pilas están compuestas por diez secciones ópticas que cubren 10 μm y se adquirieron cada 20 s. Cada pila Z es de 10 μm y está compuesta por diez secciones ópticas. El inicio de la anafase corresponde al tiempo 0 s. Las imágenes en color de fusión de los canales RFP-H2B (rojo) y CID-GFP (verde) se muestran a la izquierda. El canal CID-GFP (blanco) se muestra solo a la derecha. Los dos pares CID-GFP de cada centrómero fueron identificados y etiquetados en cada capa que componen el Z-apila en los diferentes puntos de tiempo. La distancia media entre los puntos CID-GFP es de aproximadamente 1 μm. El seguimiento de los pares de cinetocoros se realizó mediante un complemento para el software Image J. En el video, cada par CID-GFP está etiquetado con el mismo color.

Video S3. Microscopía de lapso de tiempo de células S2 que expresan de manera estable CID-GFP y RFP-H2B y empobrecidas para TOPO II, 72 h después de la adición del dsRNA

Z-Las pilas están compuestas por diez secciones ópticas que cubren 10 μm y se adquirieron cada 15 s. El inicio de la anafase corresponde al tiempo 0 s. Fusionar imágenes en color para H2B-RFP (rojo) y CID-GFP (verde).

Video S4. Microscopía de lapso de tiempo de células S2 que expresan de manera estable CID-GFP y RFP-H2B y empobrecidas para TOPO II, 96 h después de la adición del dsRNA

Z-Las pilas están compuestas por diez secciones ópticas que cubren 10 μm y se adquirieron cada 15 s. El inicio de la anafase corresponde al tiempo 0 s. Fusionar imágenes en color para H2BRFP (rojo) y CID-GFP (verde) se muestra a la izquierda. El canal separado para CID-GFP (blanco) se puede ver a la derecha. Se identificaron y etiquetaron pares de centrómeros en cada sección óptica del Z-apilar como se describe arriba. Los pares del marcador centrómero CID-GFP están etiquetados con el mismo color.

Video S5. Microscopía de lapso de tiempo de células S2 que expresan de manera estable GFP-α-tubulina y CID-mCherry

Z-se adquirieron pilas cada 40 s. Cada Z-La pila es de 10 μm y está compuesta por diez secciones ópticas. El inicio de la anafase corresponde al tiempo 0 s. Fusionar imágenes de color para CID-mCherry (rojo) y GFP-α-tubulina (verde) se muestran a la izquierda. A la derecha, se muestra el canal separado para CID-GFP (blanco) y los pares CID-GFP están etiquetados con el mismo color.

Video S6. Microscopía de lapso de tiempo de células S2 que expresan de manera estable GFP-α-tubulina y CID-mCherry que se agotaron para TOPO II, 72 h después de la adición del dsRNA

Z-se adquirieron pilas cada 40 s. Cada Z-La pila es de 10 μm y está compuesta por diez secciones ópticas. El inicio de la anafase corresponde al tiempo 0 s. Las imágenes de colores combinados para Cherry-CID (rojo) y GFP-α-tubulina (verde) se muestran a la izquierda. En el medio, se muestra el canal separado para GFP-α-tubulina (blanco) con la representación de los pares CID que componen cada centrómero (a la derecha, canal separado).

Video S7. Microscopía de lapso de tiempo de células S2 que expresan de manera estable GFP-α-tubulina y CID-mCherry

Z-Las pilas se adquirieron cada 30 s. Cada Z-La pila es de 10 μm y está compuesta por diez secciones ópticas. El inicio de la anafase corresponde al tiempo 0 s. Combinar imágenes en color para CID-mCherry (rojo) y GFP-α-tubulina (verde) se muestra a la izquierda. Los canales separados para CID-GFP (negro) y GFP-α-tubulina (negro) se muestran en el medio y a la derecha, respectivamente.

Video S8. Microscopía de lapso de tiempo de células S2 que expresan de manera estable GFP-α-tubulina y CID-mCherry que se incubaron con 50 μg / ml de ICRF-187 después del establecimiento de una unión bipolar

Z-Las pilas se adquirieron cada 30 s. Cada Z-La pila es de 10 μm y está compuesta por diez secciones ópticas. Fusionar imágenes de color para CID-mCherry (rojo) y GFP-α-tubulina (verde) se muestran a la izquierda. Los canales separados para CID-GFP (negro) y GFP-α-tubulina (negro) se muestran en el medio y a la derecha, respectivamente. Se indica el momento de la adición de ICRF-187 a una concentración final de 50 μg / ml.

Video S9. Microscopía de lapso de tiempo de células S2 que expresan de manera estable GFP-α-tubulina y CID-mCherry que se incubaron durante 1 h con 50 μg / ml de ICRF-187 antes de la grabación

Z-Las pilas se adquirieron cada 30 s. Cada Z-La pila es de 10 μm y está compuesta por diez secciones ópticas. El inicio de la anafase corresponde al tiempo 0 seg. Fusionar imágenes de color para CID-mCherry (rojo) y GFP-α-tubulina (verde) se muestran a la izquierda. Los canales separados para CID-GFP (negro) y GFP-α-tubulina (negro) se muestran en el medio y a la derecha, respectivamente. Se indica el momento de la adición de ICRF-187 a una concentración final de 50 μg / ml.

Video S10. Microscopía de lapso de tiempo de células S2 que expresan de manera estable CID-GFP y RFP-H2B que se agotaron simultáneamente de TOPO II y RAD21, 96 h después de la adición del dsRNA

Z-Las pilas se adquirieron cada 15 s. Cada Z-La pila es de 10 μm y está compuesta por diez secciones ópticas. El inicio de la anafase corresponde al tiempo 0 s. Las imágenes de colores combinados para H2B-RFP (rojo) y CID-GFP (verde) se muestran a la izquierda. El canal separado para CID-GFP (blanco) se puede ver a la derecha. Se identificaron pares de marcador centrómero CID-GFP y se etiquetaron en cada capa del Z-apila y se muestran en Video S6. Los pares de puntos CID-GFP están etiquetados con el mismo color.

Video S11. Microscopía de lapso de tiempo de células S2 que expresan de manera estable CID-GFP y RFP-H2B que se agotaron simultáneamente de TOPO II y RAD21, 96 h después de la adición del dsRNA

Z-Las pilas se adquirieron cada 15 s. Cada Z-La pila es de 10 μm y está compuesta por diez secciones ópticas. El inicio de la anafase corresponde al tiempo 0 s. Las imágenes de colores combinados para H2B-RFP (rojo) y CID-GFP (verde) se muestran a la izquierda. El canal separado para CID-GFP (blanco) se puede ver a la derecha. Se identificaron pares de marcador centrómero CID-GFP y se etiquetaron en cada capa del Z-apila y se muestran en Video S6. Los pares de puntos CID-GFP están etiquetados con el mismo color.

Video S12. Microscopía de lapso de tiempo de células S2 que expresan de manera estable CID-GFP y RFP-H2B que se agotaron de RAD21, 96 h después de la adición del dsRNA

Cada Z-La pila es de 10 μm y está compuesta por diez secciones ópticas. El inicio de la anafase corresponde al tiempo 0 s. Las imágenes en color fusionadas para H2B-RFP (rojo) y CID-GFP (verde) se muestran a la izquierda. El canal separado para CID-GFP (blanco) se puede ver a la derecha.


Alao, J. P. y Sunnerhagen, P. (2009). Los inhibidores de ATM y ATR CGK733 y la cafeína suprimen los niveles de ciclina D1 e inhiben la proliferación celular. Radiat. Oncol. 4, 51. doi: 10.1186 / 1748-717x-4-51

Alikarami, F., Safa, M., Faranoush, M., Hayat, P. y Kazemi, A. (2017). La inhibición de ADN-PK aumenta la quimiosensibilidad de las células de leucemia linfoblástica aguda precursoras de células B a la doxorrubicina. Biomed. Farmacother. 1077 & # x020131093. doi: 10.1016 / j.biopha.2017.08.022

Ampferl, R., Rodemann, H. P., Mayer, C., Hofling, T. T. A. y Dittmann, K. (2018). La falta de glucosa altera la reparación del ADN en las células tumorales de forma selectiva al bloquear la acetilación de histonas. Radiother. Oncol. 3, 465 & # x02013470. doi: 10.1016 / j.radonc.2017.10.020

Anderson, C. T. y Friedberg, E. C. (1980). La presencia de uracilo-ADN glicosilasa nuclear y mitocondrial en extractos de células KB humanas. Res de ácidos nucleicos. 4, 875.

Asaoka, Y., Ijichi, H. y Koike, K. (2015). Bloqueo de PD-1 en tumores con deficiencia de reparación de errores de apareamiento. N. Engl. J. Med. 20 de octubre de 1979. doi: 10.1056 / NEJMc1510353

Bang, Y. J., Xu, R. H., Chin, K., Lee, K. W., Park, S. H., Rha, S. Y., et al. (2017). Olaparib en combinación con paclitaxel en pacientes con cáncer gástrico avanzado que han progresado después de la terapia de primera línea (GOLD): un ensayo de fase 3, doble ciego, aleatorizado, controlado con placebo. Lancet Oncol. 12, 1637 & # x020131651. doi: 10.1016 / s1470-2045 (17) 30682-4

Biddlestone-Thorpe, L., Sajjad, M., Rosenberg, E., Beckta, J. M., Valerie, N. C., Tokarz, M., et al. (2013). La inhibición de la ATM quinasa sensibiliza preferentemente al glioma mutante p53 a la radiación ionizante. Clin. Cáncer Res. 12, 3189 & # x020133200. doi: 10.1158 / 1078-0432.ccr-12-3408

Binabaj, M. M., Bahrami, A., ShahidSales, S., Joodi, M., Joudi Mashhad, M., Hassanian, S. M., et al. (2018). El valor pronóstico de la metilación del promotor MGMT en el glioblastoma: un metanálisis de ensayos clínicos. J. Cell. Physiol. 1, 378 & # x02013386. doi: 10.1002 / jcp.25896

Bindra, R. S., Schaffer, P. J., Meng, A., Woo, J., Maseide, K., Roth, M. E., et al. (2004). Regulación descendente de Rad51 y disminución de la recombinación homóloga en células cancerosas hipóxicas. Mol. Biol celular. 19, 8504 & # x020138518.doi: 10.1128 / mcb.24.19.8504-8518.2004

Bobustuc, G. C., Patel, A., Thompson, M., Srivenugopal, K. S., Frick, J., Weese, J. y col. (2015). La inhibición de MGMT suprime la expresión de survivina en el cáncer de páncreas. Páncreas. 4, 626 & # x02013635. doi: 10.1097 / mpa.0000000000000299

Brown, J. S., O & # x02019 Carrigan, B., Jackson, S. P. y Yap, T. A. (2017). Dirigirse a la reparación del ADN en el cáncer: más allá de los inhibidores de PARP. Canc. Descubrir. 1, 20 & # x0201337. doi: 10.1158 / 2159-8290.CD-16-0860

Bryant, H. E., Schultz, N., Thomas, H. D., Parker, K. M., Flower, D., Lopez, E., et al. (2005). Eliminación específica de tumores deficientes en BRCA2 con inhibidores de poli (ADP-ribosa) polimerasa. Naturaleza. 7035, 913 y # x02013917. doi: 10.1038 / nature03443

Carruthers, R., Ahmed, S. U., Strathdee, K., Gomez-Roman, N., Amoah-Buahin, E., Watts, C., et al. (2015). Abrogación de la radiorresistencia en células madre de glioblastoma por inhibición de ATM quinasa. Mol. Oncol. 1, 192 & # x02013203. doi: 10.1016 / j.molonc.2014.08.003

Cerrato, A., Morra, F. y Celetti, A. (2016). Uso de inhibidores de poli ADP-ribosa polimerasa [PARP] en ​​células cancerosas con defectos de DDR: la justificación para su inclusión en la clínica. J. Exp. Clin. Cáncer Res. 1, 179. doi: 10.1186 / s13046-016-0456-2

Cheng, Y., Ren, X., Gowda, A. S., Shan, Y., Zhang, L., Yuan, Y. S., et al. (2013). La interacción de Sirt3 con OGG1 contribuye a la reparación del ADN mitocondrial y protege de la muerte celular apoptótica bajo estrés oxidativo. Muerte celular Dis. 4, e731. doi: 10.1038 / cddis.2013.254

Chowdhury, S. M., Surhland, C., Sánchez, Z., Chaudhary, P., Suresh Kumar, M. A., Lee, S., et al. (2015). Nanocintas de grafeno como agente de administración de fármacos para la terapia mediada por lucantona del glioblastoma multiforme. Nanomedicina 1, 109 & # x02013118. doi: 10.1016 / j.nano.2014.08.001

Ciszewski, W. M., Tavecchio, M., Dastych, J. y Curtin, N. J. (2014). La inhibición de DNA-PK por NU7441 sensibiliza a las células de cáncer de mama a la radiación ionizante y a la doxorrubicina. Res de cáncer de mama. Tratar 1, 47 & # x0201355. doi: 10.1007 / s10549-013-2785-6

Cleary, J. M., Aguirre, A. J., Shapiro, G. I. y D & # x02019 Andrea, A. D. (2020). Desarrollo guiado por biomarcadores de inhibidores de la reparación del ADN. Mol. Celda. 6, 1070 & # x020131085. doi: 10.1016 / j.molcel.2020.04.035

Clementi, E., Inglin, L., Beebe, E., Gsell, C., Garajova, Z. y Markkanen, E. (2020). El daño persistente del ADN desencadena la activación de la respuesta de estrés integrada para promover la supervivencia celular bajo restricción de nutrientes. BMC Biol 1, 36. doi: 10.1186 / s12915-020-00771-x

Clements, K. E., Thakar, T., Nicolae, C. M., Liang, X., Wang, H. G. y Moldovan, G. L. (2018). La pérdida de E2F7 confiere resistencia a los inhibidores de poli-ADP-ribosa polimerasa (PARP) en células deficientes en BRCA2. Res de ácidos nucleicos. 17, 8898 y # x020138907. doi: 10.1093 / nar / gky657

Coleman, R. L., Fleming, G. F., Brady, M. F., Swisher, E. M., Steffensen, K. D., Friedlander, M. y col. (2019). Veliparib con quimioterapia de primera línea y como terapia de mantenimiento en cáncer de ovario. N. Engl. J. Med. 25, 2403 & # x020132415. doi: 10.1056 / NEJMoa1909707

Dhillon, K. K., Bajrami, I., Taniguchi, T. y Lord, C. J. (2016). Letalidad sintética: el camino hacia nuevas terapias para el cáncer de mama. Endocr. Relat. Cáncer. 10, T39 y # x02013T55. doi: 10.1530 / erc-16-0228

Di Benedetto, A., Ercolani, C., Mottolese, M., Sperati, F., Pizzuti, L., Vici, P., et al. (2017). El análisis de las vías ATR-Chk1 y ATM-Chk2 en el cáncer de mama masculino reveló la importancia pronóstica de la expresión de ATR. Sci. Reps. 1, 8078. doi: 10.1038 / s41598-017-07366-7

Dolman, M. E., van der Ploeg, I., Koster, J., Bate-Eya, L. T., Versteeg, R., Caron, H. N., et al. (2015). Proteína quinasa dependiente de ADN como diana molecular para la radiosensibilización de células de neuroblastoma. Más uno. 12, e0145744. doi: 10.1371 / journal.pone.0145744

Durant, S. T., Zheng, L., Wang, Y., Chen, K., Zhang, L., Zhang, T., et al. (2018). El inhibidor de ATM clínico penetrante en el cerebro AZD1390 radiosensibiliza y mejora la supervivencia de modelos de tumores cerebrales preclínicos. Sci. Adv. 6, eaat1719. doi: 10.1126 / sciadv.aat1719

Erice, O., Smith, M. P., White, R., Goicoechea, I., Barriuso, J., Jones, C., et al. (2015). La expresión de MGMT predice la resistencia mediada por PARP a la temozolomida. Mol. Cáncer Ther. 5, 1236 & # x020131246. doi: 10.1158 / 1535-7163.mct-14-0810

Farago, A. F., Yeap, B. Y., Stanzione, M., Hung, Y. P., Heist, R. S., Marcoux, J. P., et al. (2019). Combinación de olaparib y temozolomida en el cáncer de pulmón microcítico recidivante. Cancer Discov. 10, 1372 & # x020131387. doi: 10.1158 / 2159-8290.cd-19-0582

Farmer, H., McCabe, N., Lord, C. J., Tutt, A. N., Johnson, D. A., Richardson, T. B., et al. (2005). Dirigirse al defecto de reparación del ADN en células mutantes BRCA como estrategia terapéutica. Naturaleza. 7035, 917 y # x02013921. doi: 10.1038 / nature03445

Fishel, M. L., Xia, H., McGeown, J., McIlwain, D. W., Elbanna, M., Craft, A. A., et al. (2019). Actividad antitumoral y caracterización mecanicista de inhibidores de APE1 / ref-1 en cáncer de vejiga. Mol. Cáncer Ther. 11, 1947 & # x020131960. doi: 10.1158 / 1535-7163.mct-18-1166

Foote, K. M., Blades, K., Cronin, A., Fillery, S., Guichard, S. S., Hassall, L., et al. (2013). Descubrimiento de 4- <4 - [(3R) -3-Metilmorfolin-4-il] -6- [1- (metilsulfonil) ciclopropil] pirimidin-2-il> -1H-indol (AZ20): un inhibidor potente y selectivo de proteína quinasa ATR con monoterapia en vivo actividad antitumoral. J. Med. Chem. 5, 2125 & # x020132138. doi: 10.1021 / jm301859s

Fukumoto, T., Zhu, H., Nacarelli, T., Karakashev, S., Fatkhutdinov, N., Wu, S., et al. (2019). La N (6) -metilación de la adenosina del ARNm de FZD10 contribuye a la resistencia al inhibidor de PARP. Cáncer Res. 11, 2812 y # x020132820. doi: 10.1158 / 0008-5472.can-18-3592

Gao, X., Wang, J., Li, M., Wang, J., Lv, J., Zhang, L. y col. (2019). La berberina atenúa la reparación por escisión de bases mediada por XRCC1 y sensibiliza las células del cáncer de mama a los fármacos quimioterapéuticos. J. Cell Mol. Medicina. 10, 6797 y # x020136804. doi: 10.1111 / jcmm.14560

Germano, G., Lamba, S., Rospo, G., Barault, L., Magr & # x000ec, A., Maione, F., et al. (2017). La inactivación de la reparación del ADN desencadena la generación de neoantígenos y altera el crecimiento tumoral. Naturaleza. 7683, 116 y # x02013120. doi: 10.1038 / nature24673

Giglia-Mari, G., Zotter, A. y Vermeulen, W. (2011). Respuesta al daño del ADN. Arb de resorte frío. Perspect. Biol. 1, a000745. doi: 10.1101 / cshperspect.a000745

Gogola, E., Duarte, A. A., de Ruiter, J. R., Wiegant, W. W., Schmid, J. A., de Bruijn, R., et al. (2018). La pérdida selectiva de PARG restaura la PARilación y contrarresta la letalidad sintética mediada por el inhibidor de PARP. Célula cancerosa. 6, 1078 & # x020131093.e12. doi: 10.1016 / j.ccell.2018.05.008

Golan, T., Hammel, P., Reni, M., Van Cutsem, E., Macarulla, T., Hall, M. J., et al. (2019). Olaparib de mantenimiento para el cáncer de páncreas metastásico con mutación en BRCA de la línea germinal. N. Engl. J. Med. 4, 317 & # x02013327. doi: 10.1056 / NEJMoa1903387

Grishko, V. I., Rachek, L. I., Spitz, D. R., Wilson, G. L. y LeDoux, S. P. (2005). Contribución de la reparación del ADN mitocondrial a la resistencia celular al estrés oxidativo. J. Biol. Chem. 10, 8901 y # x020138905. doi: 10.1074 / jbc.M413022200

Gr & # x000f6schel, S., H & # x000fcbschmann, D., Raimondi, F., Horak, P., Warsow, G., Fr & # x000f6hlich, M., et al. (2019). Reparación de ADN de recombinación homóloga defectuosa como diana terapéutica en cordoma avanzado. Nat. Comun. 1, 1635. doi: 10.1038 / s41467-019-09633-9

Guertin, A. D., Li, J., Liu, Y., Hurd, M. S., Schuller, A. G., Long, B. y col. (2013). Evaluación preclínica del inhibidor de WEE1 MK-1775 como terapia anticancerosa de agente único. Mol. Cáncer Ther. 8, 1442 & # x020131452. doi: 10.1158 / 1535-7163.MCT-13-0025

Gurjao, C., Liu, D., Hofree, M., AlDubayan, S. H., Wakiro, I., Su, M. J., et al. (2019). Resistencia intrínseca al bloqueo de puntos de control inmunológico en un cáncer colorrectal deficiente en reparación de desajustes. Cancer Immunol. Res. 8, 1230 & # x020131236. doi: 10.1158 / 2326-6066.CIR-18-0683

Hampel, H., Frankel, W. L., Martin, E., Arnold, M., Khanduja, K., Kuebler, P., et al. (2005). Detección del síndrome de Lynch (cáncer colorrectal hereditario sin poliposis). N. Engl. J. Med. 18, 1851 & # x020131860. doi: 10.1056 / NEJMoa043146

Hanahan, D. y Weinberg, R. A. (2011). Distintivos del cáncer: la próxima generación. Celda. 5, 646 & # x02013674. doi: 10.1016 / j.cell.2011.02.013

Happold, C., Stojcheva, N., Silginer, M., Weiss, T., Roth, P., Reifenberger, G., et al. (2018). Control transcripcional de la expresión de O (6) -metilguanina ADN metiltransferasa y resistencia a temozolomida en glioblastoma. J. Neurochem. 6, 780 & # x02013790. doi: 10.1111 / jnc.14326

Hegi, M. E., Diserens, A. C., Gorlia, T., Hamou, M. F., de Tribolet, N., Weller, M., et al. (2005). Silenciamiento del gen MGMT y beneficio de la temozolomida en el glioblastoma. N. Engl. J. Med. 10, 997 & # x020131003. doi: 10.1056 / NEJMoa043331

Henneman, L., van Miltenburg, M. H., Michalak, E. M., Braumuller, T. M., Jaspers, J. E., Drenth, A. P., et al. (2015). Resistencia selectiva al inhibidor de PARP olaparib en un modelo de ratón para cáncer de mama metaplásico deficiente en BRCA1. Proc. Natl. Acad. Sci. ESTADOS UNIDOS. 27, 8409 & # x020138414. doi: 10.1073 / pnas.1500223112

Hickson, I., Zhao, Y., Richardson, C. J., Green, S. J., Martin, N. M., Orr, A. I., et al. (2004). Identificación y caracterización de un inhibidor nuevo y específico de la ataxia-telangiectasia quinasa mutada ATM. Cáncer Res. 24, 9152 & # x020139159. doi: 10.1158 / 0008-5472.can-04-2727

Hoey, C., Ray, J., Jeon, J., Huang, X., Taeb, S., Ylanko, J. y col. (2018). Radiorresistencia del miRNA-106a y del cáncer de próstata: un papel novedoso de LITAF en la regulación de ATM. Mol. Oncol. 8, 1324 & # x020131341. doi: 10.1002 / 1878-0261.12328

Hosoya, N. y Miyagawa, K. (2014). Dirigirse a la respuesta al daño del ADN en la terapia del cáncer. Ciencia del cáncer. 4, 370 & # x02013388. doi: 10.1111 / cas.12366

Hsu, S. H., Chen, S. H., Kuo, C. C. y Chang, J. Y. (2018). La enzima conjugadora de ubiquitina E2 B regula la ubiquitinación de la O (6) -metilguanina-ADN metiltransferasa y la sensibilidad a BCNU en células de carcinoma nasofaríngeo humano. Biochem. Pharmacol. 158, 327 & # x02013338. doi: 10.1016 / j.bcp.2018.10.029

Huang, F. y Mazin, A. V. (2014). Un inhibidor de molécula pequeña de RAD51 humano potencia la destrucción de células de cáncer de mama mediante agentes terapéuticos en xenoinjertos de ratón. Más uno. 6, e100993. doi: 10.1371 / journal.pone.0100993

Iaccarino, C., Orlandi, E., Ruggeri, F., Nicoli, D., Torricelli, F., Maggi, M., et al. (2015). Valor pronóstico del estado del promotor MGMT en el glioblastoma no resecable después de la terapia adyuvante. Clin. Neurol. Neurocirujano. 132, 1 & # x020138. doi: 10.1016 / j.clineuro.2015.01.029

Jackson, S. P. y Bartek, J. (2009). La respuesta al daño del ADN en la biología y la enfermedad humanas. Naturaleza. 7267, 1071 & # x020131078. doi: 10.1038 / nature08467

Jette, N. y Lees-Miller, S. P. (2015). La proteína quinasa dependiente de ADN: una proteína quinasa multifuncional con funciones en la reparación de roturas de doble hebra del ADN y en la mitosis. Prog. Biophys. Mol. Biol. 2-3, 194 & # x02013205. doi: 10.1016 / j.pbiomolbio.2014.12.003

Jiao, S., Xia, W., Yamaguchi, H., Wei, Y., Chen, M. K., Hsu, J. M., et al. (2017). El inhibidor de PARP aumenta la expresión de PD-L1 y mejora la inmunosupresión asociada al cáncer. Clin. Cáncer Res. 14, 3711 & # x020133720. doi: 10.1158 / 1078-0432.ccr-16-3215

Jin, M. H. y Oh, D. Y. (2019). ATM en la reparación del ADN en el cáncer. Pharmacol. El r. [Publicación electrónica antes de la impresión]. doi: 10.1016 / j.pharmthera.2019.07.002

Jue, T. R., Nozue, K., Lester, A. J., Joshi, S., Schroder, L. B., Whittaker, S. P., et al. (2017). Veliparib en combinación con radioterapia para el tratamiento del glioblastoma no metilado MGMT. J. Transl. Medicina. 1, 61. doi: 10.1186 / s12967-017-1164-1

Kaufman, B., Shapira-Frommer, R., Schmutzler, R. K., Audeh, M. W., Friedlander, M., Balmana, J. y col. (2015). Monoterapia con olaparib en pacientes con cáncer avanzado y una mutación de la línea germinal BRCA1 / 2. J. Clin. Oncol. 3, 244 & # x02013250. doi: 10.1200 / jco.2014.56.2728

Kettner, N. M., Vijayaraghavan, S., Durak, M. G., Bui, T., Kohansal, M., Ha, M. J., et al. (2019). Inhibición combinada de STAT3 y reparación del ADN en cáncer de mama ER positivo resistente a palbociclib. Clin. Cáncer Res. 13, 3996 & # x020134013. doi: 10.1158 / 1078-0432.ccr-18-3274

Kim, G., Ison, G., McKee, A. E., Zhang, H., Tang, S., Gwise, T., et al. (2015). Resumen de aprobación de la FDA: monoterapia con olaparib en pacientes con cáncer de ovario avanzado con mutación en BRCA de la línea germinal nociva tratadas con tres o más líneas de quimioterapia. Clin. Cáncer Res. 19, 4257 & # x020134261. doi: 10.1158 / 1078-0432.ccr-15-0887

Kim, Y. S., Kim, S. H., Cho, J., Kim, J. W., Chang, J. H., Kim, D. S., et al. (2012). Metilación del promotor del gen MGMT como un potente factor pronóstico en el glioblastoma tratado con quimiorradioterapia basada en temozolomida: un estudio de una sola institución. En t. J. Radiat. Oncol. Biol. Phys. 3, 661 & # x02013667. doi: 10.1016 / j.ijrobp.2011.12.086

King, H. O., Brend, T., Payne, H. L., Wright, A., Ward, T. A., Patel, K., et al. (2017). RAD51 es un objetivo de reparación selectiva del ADN para radiosensibilizar las células madre de glioma. Representante de células madre. 1, 125 & # x02013139. doi: 10.1016 / j.stemcr.2016.12.005

Konecny, G. E. y Kristeleit, R. S. (2016). Inhibidores de PARP para el cáncer de ovario esporádico y con mutación BRCA1 / 2: práctica actual y direcciones futuras. Br. J. Cáncer. 10, 1157 y # x020131173. doi: 10.1038 / bjc.2016.311

Konstantinopoulos, P. A., Barry, W. T., Birrer, M., Westin, S. N., Cadoo, K. A., Shapiro, G. I., et al. (2019). Olaparib y alpelisib inhibidor de PI3K específico de & # x003b1 para pacientes con cáncer de ovario epitelial: un ensayo de fase 1b de aumento y expansión de dosis. Lancet Oncol. 4, 570 & # x02013580. doi: 10.1016 / s1470-2045 (18) 30905-7

Koosha, F., Neshasteh-Riz, A., Takavar, A., Eyvazzadeh, N., Mazaheri, Z., Eynali, S., et al. (2017). La combinación de A-966492 y Topotecan para una radiosensibilización eficaz en esferoides de glioblastoma. Biochem. Biophys. Res. Comun. 4, 1092 y # x020131097. doi: 10.1016 / j.bbrc.2017.08.018

Le, D. T., Durham, J. N., Smith, K. N., Wang, H., Bartlett, B. R., Aulakh, L. K., et al. (2017). La deficiencia de reparación de desajustes predice la respuesta de los tumores sólidos al bloqueo de PD-1. Ciencias. 6349, 409 y # x02013413. doi: 10.1126 / science.aan6733

Lee, A., Youssef, I., Osborn, V. W., Safdieh, J., Becker, D. J. y Schreiber, D. (2018). La utilización de las pruebas de metilación del promotor MGMT en los hospitales de los Estados Unidos para el glioblastoma y su impacto en el pronóstico. J. Clin. Neurosci. 51, 85 y # x0201390. doi: 10.1016 / j.jocn.2018.02.009

Lim, K. S., Li, H., Roberts, E. A., Gaudiano, E. F., Clairmont, C., Sambel, L. A., et al. (2018). Se requiere USP1 para la protección de la horquilla de replicación en tumores deficientes en BRCA1. Mol. Celda. 6, 925 & # x02013941.e4. doi: 10.1016 / j.molcel.2018.10.045

Liu, J. F., Barry, W. T., Birrer, M., Lee, J. M., Buckanovich, R. J., Fleming, G. F., et al. (2019). Supervivencia general y resultados actualizados de supervivencia libre de progresión en un estudio aleatorizado de fase II de combinación de cediranib y olaparib versus olaparib en el cáncer de ovario sensible al platino en recaída. Ana. Oncol. 4, 551 & # x02013557. doi: 10.1093 / annonc / mdz018

Liu, L., Cai, S., Han, C., Banerjee, A., Wu, D., Cui, T. y col. (2020). ALDH1A1 contribuye a la resistencia a los inhibidores de PARP mediante la mejora de la reparación del ADN en las células de cáncer de ovario BRCA2 (- / -). Mol. Cáncer Ther. 1, 199 & # x02013210. doi: 10.1158 / 1535-7163.mct-19-0242

Liu, L., Yan, L., Donze, J. R. y Gerson, S. L. (2003). El bloqueo de la reparación del sitio básico mejora la eficacia antitumoral de 1,3-bis- (2-cloroetil) -1-nitrosourea en xenoinjertos de tumores de colon. Mol. Cáncer Ther. 10, 1061

Liu, Y., Zhang, L., Liu, Y., Sun, C., Zhang, H., Miao, G. y col. (2015). La deficiencia de DNA-PKcs inhibe la angiogénesis derivada de células de glioblastoma después de la radiación ionizante. J. Cell. Physiol. 5, 1094 & # x020131103. doi: 10.1002 / jcp.24841

Loibl, S., O & # x00027 Shaughnessy, J., Untch, M., Sikov, W. M., Rugo, H. S., McKee, M. D., et al. (2018). Adición del inhibidor de PARP veliparib más carboplatino o carboplatino solo a la quimioterapia neoadyuvante estándar en el cáncer de mama triple negativo (BrighTNess): un ensayo aleatorizado de fase 3. Lancet Oncol. 4, 497 & # x02013509. doi: 10.1016 / s1470-2045 (18) 30111-6

Lord, C. J. y Ashworth, A. (2017). Inhibidores de PARP: letalidad sintética en la clínica. Ciencias. 6330, 1152 & # x020131158. doi: 10.1126 / science.aam7344

Lu, Y., Chu, A., Turker, M. S. y Glazer, P. M. (2011). Regulación epigenética inducida por hipoxia y silenciamiento del promotor BRCA1. Mol. Biol celular. 16, 3339 & # x020133350. doi: 10.1128 / mcb.01121-10

Luo, M. y Kelley, M. R. (2004). Inhibición de la actividad reparadora de la endonucleasa apurínica / apirimidínica humana (APE1) y sensibilización de las células de cáncer de mama a los agentes alquilantes del ADN con lucantona. Res contra el cáncer. 4, 2127

Ma, H., Takahashi, A., Yoshida, Y., Adachi, A., Kanai, T., Ohno, T., et al. (2015). La combinación de la irradiación de iones de carbono y el inhibidor de reparación de unión de extremos no homólogo NU7026 mata eficazmente las células cancerosas. Radiat. Oncol. 10, 225. doi: 10.1186 / s13014-015-0536-z

Ma, J., Benítez, J. A., Li, J., Miki, S., Ponte de Albuquerque, C., Galatro, T., et al. (2019). La inhibición de la fosforilación de tirosina de PTEN nuclear aumenta la sensibilidad a la radiación del glioma a través de la reparación atenuada del ADN. Célula cancerosa. 3, 504 & # x02013518.e7. doi: 10.1016 / j.ccell.2019.01.020

Maki, Y., Murakami, J., Asaumi, J., Tsujigiwa, H., Nagatsuka, H., Kokeguchi, S., et al. (2005). Papel de O6-metilguanina-ADN metiltransferasa y efecto de O6-bencilguanina sobre la actividad antitumoral de cis-diaminedicloroplatino (II) en líneas celulares de cáncer oral. Oncol oral. 10, 984 & # x02013993. doi: 10.1016 / j.oraloncology.2005.05.011

Marzio, A., Puccini, J., Kwon, Y., Maverakis, N. K., Arbini, A., Sung, P., et al. (2019). La actividad dependiente del dominio de la caja F de EMI1 regula la sensibilidad de PARPi en los cánceres de mama triple negativos. Mol. Celda. 2, 224 & # x02013237.e6. doi: 10.1016 / j.molcel.2018.11.003

Memon, D., Dawson, K., Smowton, C. S., Xing, W., Dive, C. y Miller, C. J. (2016). El empalme impulsado por la hipoxia en isoformas no codificantes regula la respuesta al daño del ADN. NPJ Genom. Medicina. 1, 16020. doi: 10.1038 / npjgenmed.2016.20

Middleton, M. R. y Margison, G. P. (2003). Mejora de la eficacia de la quimioterapia mediante la inactivación de una vía de reparación del ADN. Lancet Oncol. 1, 37 & # x0201344. doi: 10.1016 / s1470-2045 (03) 00959-8

Middleton, M. R., Thatcher, N., McMurry, T. B., McElhinney, R. S., Donnelly, D. J. y Margison, G. P. (2002). Efecto de O6- (4-bromotenil) guanina en diferentes programas de temozolomida en un modelo de xenoinjerto de melanoma humano. En t. J. Cáncer. 5, 615 & # x02013617. doi: 10.1002 / ijc.10532

Mihaylova, V. T., Bindra, R. S., Yuan, J., Campisi, D., Narayanan, L., Jensen, R., et al. (2003). Disminución de la expresión del gen de reparación de errores de apareamiento de ADN Mlh1 bajo estrés hipóxico en células de mamíferos. Mol. Biol celular. 9, 3265 & # x020133273. doi: 10.1128 / mcb.23.9.3265-3273.2003

Montaldi, A. P. y Sakamoto-Hojo, E. T. (2013). La metoxiamina sensibiliza la línea celular resistente del glioblastoma T98G al agente alquilante temozolomida. Clin. Exp. Medicina. 4, 279 & # x02013288. doi: 10.1007 / s10238-012-0201-x

Moore, K., Colombo, N., Scambia, G., Kim, B. G., Oaknin, A., Friedlander, M. y col. (2018). Olaparib de mantenimiento en pacientes con cáncer de ovario avanzado recién diagnosticado. N. Engl. J. Med. 26, 2495 & # x020132505. doi: 10.1056 / NEJMoa1810858

Morgado-Palacin, I., Day, A., Murga, M., Lafarga, V., Anton, M. E., Tubbs, A., et al. (2016). Dirigirse a las actividades quinasas de ATR y ATM exhibe actividad antitumoral en modelos de ratón de LMA con reordenamiento de MLL. Sci. Señal. 445, ra91. doi: 10.1126 / scisignal.aad8243

Muralidharan, S. V., Bhadury, J., Nilsson, L. M., Green, L. C., McLure, K. G. y Nilsson, J. A. (2016). Los inhibidores de bromodominio BET se sinergizan con los inhibidores de ATR para inducir daño en el ADN, apoptosis, vía secretora asociada a la senescencia y estrés ER en células de linfoma inducido por Myc. Oncogén. 36, 4689 y # x020134697. doi: 10.1038 / onc.2015.521

Neboori, H. J., Haffty, B. G., Wu, H., Yang, Q., Aly, A., Goyal, S., et al. (2012). La baja expresión de la proteína de unión a p53 1 (53BP1) se asocia con un aumento de la recurrencia local en pacientes con cáncer de mama tratadas con cirugía y radioterapia para conservar la mama. En t. J. Radiat. Oncol. Biol. Phys. 5, e677 y # x0201383. doi: 10.1016 / j.ijrobp.2012.01.089

Neijenhuis, S., Begg, A. C. y Vens, C. (2005). La radiosensibilización por un negativo dominante a la ADN polimerasa beta es independiente de la ADN polimerasa beta y dependiente de XRCC1. Radiother. Oncol. 2, 123 & # x02013128. doi: 10.1016 / j.radonc.2005.06.020

Ohta, S. (2006). Contribución de mutaciones somáticas en el genoma mitocondrial al desarrollo de cáncer y tolerancia a fármacos anticancerosos. Oncogén. 34, 4768 y # x020134776. doi: 10.1038 / sj.onc.1209602

Oleinick, N. L., Biswas, T., Patel, R., Tao, M., Patel, R., Weeks, L. y col. (2016). Radiosensibilización de células de cáncer de pulmón de células no pequeñas y xenoinjertos mediante los efectos interactivos de pemetrexed y metoxiamina. Radiother. Oncol. 2, 335 & # x02013341. doi: 10.1016 / j.radonc.2016.10.007

Oliver, T. G., Mercer, K. L., Sayles, L. C., Burke, J. R., Mendus, D., Lovejoy, K. S., et al. (2010). El tratamiento crónico con cisplatino promueve una mejor reparación del daño y la progresión del tumor en un modelo de ratón de cáncer de pulmón. Desarrollo de genes. 8, 837 & # x02013852. doi: 10.1101 / gad.1897010

Oplustil O & # x02019 Connor, L., Rulten, S. L., Cranston, A. N., Odedra, R., Brown, H., Jaspers, J. E., et al. (2016). El inhibidor de PARP AZD2461 proporciona información sobre el papel de la inhibición de PARP3 para la letalidad sintética y la tolerabilidad con quimioterapia en modelos preclínicos. Cáncer Res. 20, 6084 y # x020136094. doi: 10.1158 / 0008-5472.CAN-15-3240

Pantelidou, C., Sonzogni, O., De Oliveria Taveira, M., Mehta, A. K., Kothari, A., Wang, D., et al. (2019). La eficacia del inhibidor de PARP depende del reclutamiento de células T CD8 (& # x0002b) a través de la activación de la vía STING intratumoral en modelos de cáncer de mama triple negativo con deficiencia de BRCA. Cancer Discov. 6, 722 & # x02013737. doi: 10.1158 / 2159-8290.cd-18-1218

Pearl, L. H., Schierz, A. C., Ward, S. E., Al-Lazikani, B. y Pearl, F. M. (2015). Oportunidades terapéuticas dentro de la respuesta al daño del ADN. Nat. Rev.Cáncer. 3, 166 & # x02013180. doi: 10.1038 / nrc3891

Pilie, P. G., Tang, C., Mills, G. B. y Yap, T. A. (2019). Estrategias de vanguardia para atacar la respuesta al daño del ADN en el cáncer. Nat. Rev. Clin. Oncol. 2, 81 & # x02013104. doi: 10.1038 / s41571-018-0114-z

Porporato, P. E., Filigheddu, N., Pedro, J. M. B., Kroemer, G. y Galluzzi, L. (2018). Cáncer y metabolismo mitocondrial. Res celular. 3, 265 & # x02013280. doi: 10.1038 / cr.2017.155

Powell, S. N. y Bindra, R. S. (2009). Dirigirse a la respuesta al daño del ADN para la terapia del cáncer. Reparación de ADN. 9, 1153 & # x020131165. doi: 10.1016 / j.dnarep.2009.04.011

Quigley, D., Alumkal, J. J., Wyatt, A. W., Kothari, V., Foye, A., Lloyd, P., et al. (2017). El análisis del ADN libre de células circulantes identifica la heterogeneidad multiclonal de las mutaciones de reversión de BRCA2 asociadas con la resistencia a los inhibidores de PARP. Cancer Discov. 9, 999 & # x020131005. doi: 10.1158 / 2159-8290.cd-17-0146

Rabik, C. A., Njoku, M. C. y Dolan, M. E. (2006). Inactivación de la O6-alquilguanina ADN alquiltransferasa como medio para mejorar la quimioterapia. Tratamiento contra el cáncer Rev. 4, 261 & # x02013276. doi: 10.1016 / j.ctrv.2006.03.004

Rachek, L. I., Grishko, V. I., Musiyenko, S. I., Kelley, M. R., LeDoux, S. P. y Wilson, G. L. (2002). Orientación condicional de la enzima de reparación del ADN hOGG1 en las mitocondrias. J. Biol. Chem. 47, 44932 & # x0201344937. doi: 10.1074 / jbc.M208770200

Ranson, M., Middleton, M. R., Bridgewater, J., Lee, S. M., Dawson, M., Jowle, D. y col. (2006). Lomeguatrib, un potente inhibidor de la O6-alquilguanina-ADN-alquiltransferasa: ensayo y evaluación de seguridad, farmacodinámica y farmacocinética de fase I en combinación con temozolomida en pacientes con tumores sólidos avanzados. Clin. Cáncer Res. 5, 1577 & # x020131584. doi: 10.1158 / 1078-0432.ccr-05-2198

Riaz, N., Blecua, P., Lim, R. S., Shen, R., Higginson, D. S., Weinhold, N., et al. (2017). Análisis de cáncer de pan de alteraciones bialélicas en genes de reparación de ADN de recombinación homóloga. Nat. Comun. 1, 857. doi: 10.1038 / s41467-017-00921-w

Robson, M., Im, S. A., Senkus, E., Xu, B., Domchek, S. M., Masuda, N., et al. (2017). Olaparib para el cáncer de mama metastásico en pacientes con una mutación de BRCA de la línea germinal. N. Engl. J. Med. 6, 523 & # x02013533. doi: 10.1056 / NEJMoa1706450

Ruiz-Ba & # x000f1obre, J. y Goel, A. (2019). Deficiencia de reparación de desajustes de ADN e inhibidores de puntos de control inmunitarios en cánceres gastrointestinales. Gastroenterología. 4, 890 & # x02013903. doi: 10.1053 / j.gastro.2018.11.071

Saki, M. y Prakash, A. (2017). Diafonía relacionada con el daño del ADN entre el núcleo y las mitocondrias. Radic libre. Biol. Medicina. 216 & # x02013227. doi: 10.1016 / j.freeradbiomed.2016.11.050

Seo, Y. y Kinsella, T. J. (2009). Papel esencial de la reparación por escisión de bases de ADN en la supervivencia en un microambiente tumoral ácido. Cáncer Res. 18, 7285 & # x020137293. doi: 10.1158 / 0008-5472.can-09-0624

Shi, Q., Maas, L., Veith, C., Van Schooten, F. J. y Godschalk, R. W. (2017). El microambiente celular ácido modifica el daño y la reparación del ADN inducido por carcinógenos. Arco. Toxicol. 6, 2425 & # x020132441. doi: 10.1007 / s00204-016-1907-4

Shi, Y., Wang, Y., Qian, J., Yan, X., Han, Y., Yao, N., et al. (2020). La expresión de MGMT afecta la resistencia a gemcitabina de las células de cáncer de páncreas. Ciencia de la vida. 259, 118148. doi: 10.1016 / j.lfs.2020.118148

Shinohara, E. T., Geng, L., Tan, J., Chen, H., Shir, Y., Edwards, E., et al. (2005). La proteína quinasa dependiente de ADN es un objetivo molecular para el desarrollo de fármacos sensibilizantes a la radiación no citotóxicos. Cáncer Res. 12, 4987 & # x020134992. doi: 10.1158 / 0008-5472.can-04-4250

Shokolenko, I. N., Alexeyev, M. F., Robertson, F. M., LeDoux, S. P. y Wilson, G. L. (2003). La expresión de exonucleasa III de E. coli en las mitocondrias de las células de cáncer de mama disminuye la capacidad de reparación del ADN mitocondrial y la supervivencia celular después del estrés oxidativo. Reparación de ADN. 2, 471 & # x02013482. doi: 10.1016 / s1568-7864 (03) 00019-3

Smith, J., Tho, L. M., Xu, N. y Gillespie, D. A. (2010). Las vías ATM-Chk2 y ATR-Chk1 en la señalización del daño del ADN y el cáncer. Adv. Cáncer Res. 73 & # x02013112. doi: 10.1016 / b978-0-12-380888-2.00003-0

Squatrito, M., Brennan, C. W., Helmy, K., Huse, J. T., Petrini, J. H. y Holland, E. C. (2010). La pérdida de los componentes de la vía ATM / Chk2 / p53 acelera el desarrollo del tumor y contribuye a la resistencia a la radiación en los gliomas. Célula cancerosa. 6, 619 & # x02013629. doi: 10.1016 / j.ccr.2010.10.034

Stefanski, C. D., Keffler, K., McClintock, S., Milac, L. y Prosperi, J. R. (2019). La pérdida de APC afecta la reparación del daño del ADN causando resistencia a la doxorrubicina en las células de cáncer de mama. Neoplasia. 12, 1143 & # x020131150. doi: 10.1016 / j.neo.2019.09.002

Sunada, S., Kanai, H., Lee, Y., Yasuda, T., Hirakawa, H., Liu, C., et al. (2016). La concentración no tóxica del inhibidor de ADN-PK NU7441 radio-sensibiliza las células tumorales de pulmón con poco efecto sobre la reparación de roturas de doble cadena. Ciencia del cáncer. 9, 1250 & # x020131255. doi: 10.1111 / cas.12998

Teng, P. N., Bateman, N. W., Darcy, K. M., Hamilton, C. A., Maxwell, G. L., Bakkenist, C. J., et al. (2015). La inhibición farmacológica de ATR y ATM ofrece distinciones clínicamente importantes para mejorar la respuesta del platino o la radiación en las células cancerosas de ovario, endometrio y cuello uterino. Gynecol. Oncol. 3, 554 & # x02013561. doi: 10.1016 / j.ygyno.2014.12.035

Teo, M. Y., Seier, K., Ostrovnaya, I., Regazzi, A. M., Kania, B. E., Moran, M. M., et al. (2018). Alteraciones en la respuesta al daño del ADN y genes de reparación como marcador potencial de beneficio clínico del bloqueo de PD-1 / PD-L1 en cánceres uroteliales avanzados. J. Clin. Oncol. 17, 1685 & # x020131694. doi: 10.1200 / jco.2017.75.7740

Ter Brugge, P., Kristel, P., van der Burg, E., Boon, U., de Maaker, M., Lips, E., et al. (2016). Mecanismos de resistencia a la terapia en modelos de xenoinjerto derivados de pacientes de cáncer de mama deficiente en BRCA1. J. Natl. Cáncer Inst. 112, 1075. doi: 10.1093 / jnci / djw148

Tian, ​​H., Gao, Z., Li, H., Zhang, B., Wang, G., Zhang, Q. y col. (2015). Respuesta al daño del ADN: un arma de doble filo en la prevención y la terapia del cáncer. Cáncer Lett. 1, 8 & # x0201316. doi: 10.1016 / j.canlet.2014.12.038

Tran, T. Q., Ishak Gabra, M. B., Lowman, X. H., Yang, Y., Reid, M. A., Pan, M., et al. (2017). La deficiencia de glutamina induce daños por alquilación del ADN y sensibiliza a las células cancerosas a los agentes alquilantes mediante la inhibición de las enzimas ALKBH. PLoS Biol. 11, e2002810. doi: 10.1371 / journal.pbio.2002810

Tsai, A. K., Khan, A. Y., Worgo, C. E., Wang, L. L., Liang, Y. y Davila, E. (2017). Una combinación de multiquinasa e inhibidor de ADN-PK inmunomodula los melanomas, suprime la progresión del tumor y mejora las inmunoterapias. Cancer Immunol. Res. 9, 790 y # x02013803. doi: 10.1158 / 2326-6066.CIR-17-0009

Ueta, E., Sasabe, E., Yang, Z., Osaki, T. y Yamamoto, T. (2008). Aumento del daño apoptótico de las células del carcinoma de células escamosas mediante la inhibición del sistema de reparación del ADN mitocondrial. Ciencia del cáncer. 11, 2230 & # x020132237. doi: 10.1111 / j.1349-7006.2008.00918.x

Vázquez-Ortiz, G., Chisholm, C., Xu, X., Lahusen, T. J., Li, C., Sakamuru, S., et al. (2014). El cribado de reutilización de fármacos identifica que el lestaurtinib amplifica la capacidad del inhibidor de la poli (ADP-ribosa) polimerasa 1 AG14361 para matar las células mutantes del gen 1 asociadas al cáncer de mama y las células de cáncer de mama de tipo salvaje. Res cáncer de mama. 3, R67. doi: 10.1186 / bcr3682

Viel, T., Monfared, P., Schelhaas, S., Fricke, I. B., Kuhlmann, M. T., Fraefel, C., et al. (2013). Optimización de la quimioterapia con temozolomida del glioblastoma que emplea tecnología de ARNhc anti-MGMT basada en lentivirales. Mol. El r. 3, 570 & # x02013579. doi: 10.1038 / mt.2012.278

Wang, B., Qiao, L., Wang, Y., Zeng, J., Chen, D., Guo, H. y col. (2018). Las lesiones del lazo D del ADN mitocondrial con la mejora de la reparación del ADN contribuyen a la progresión del cáncer gastrointestinal. Oncol. Reps. 6, 3694 y # x020133704. doi: 10.3892 / o.2018.6724

Wang, Y., Xu, H., Liu, T., Huang, M., Butter, P. P., Li, C., et al. (2018). La activación temporal del ADN-PK impulsa la inestabilidad genómica y la resistencia a la terapia en las células madre de glioma. Perspectiva de la JCI. 3, e98096. doi: 10.1172 / jci.insight.98096

Wang, L. E., Yin, M., Dong, Q., Stewart, D. J., Merriman, K. W., Amos, C. I., et al. (2011). La capacidad de reparación del ADN en los linfocitos periféricos predice la supervivencia de los pacientes con cáncer de pulmón de células no pequeñas tratados con quimioterapia de primera línea basada en platino. J. Clin. Oncol. 31, 4121 y # x020134128. doi: 10.1200 / JCO.2010.34.3616

Watson, Z. L., Yamamoto, T. M., McMellen, A., Kim, H., Hughes, C. J., Wheeler, L. J. y col. (2019). Las histonas metiltransferasas EHMT1 y EHMT2 (GLP / G9A) mantienen la resistencia a los inhibidores de PARP en el carcinoma de ovario seroso de alto grado. Clin. Epigenet. 1, 165. doi: 10.1186 / s13148-019-0758-2

Weber, A. M. y Ryan, A. J. (2015). ATM y ATR como dianas terapéuticas en cáncer. Pharmacol. El r. 149, 124 & # x02013138. doi: 10.1016 / j.pharmthera.2014.12.001

Wilson, R. H., Evans, T. J., Middleton, M. R., Molife, L. R., Spicer, J., Dieras, V., et al. (2017). Un estudio de fase I de rucaparib intravenoso y oral en combinación con quimioterapia en pacientes con tumores sólidos avanzados. Br. J. Cáncer. 7, 884 & # x02013892. doi: 10.1038 / bjc.2017.36

Win, A. K., Young, J. P., Lindor, N. M., Tucker, K. M., Ahnen, D. J., Young, G. P., et al. (2012). Riesgos de cáncer colorrectal y de otro tipo para portadores y no portadores de familias con una mutación del gen de reparación de desajustes de ADN: un estudio de cohorte prospectivo. J. Clin. Oncol. 9, 958 y # x02013964. doi: 10.1200 / jco.2011.39.5590

Wise, H. C., Iyer, G. V., Moore, K., Temkin, S. M., Gordon, S., Aghajanian, C., et al. (2019). Actividad de M3814, un inhibidor de DNA-PK oral, en combinación con inhibidores de topoisomerasa II en modelos de cáncer de ovario. Sci. Reps. 1, 18882. doi: 10.1038 / s41598-019-54796-6

Wu, X., Luo, Q., Zhao, P., Chang, W., Wang, Y., Shu, T., et al. (2019). DUB3 activado por MGMT estabiliza MCL1 e impulsa la quimiorresistencia en el cáncer de ovario. Proc. Natl. Acad. Sci. ESTADOS UNIDOS. 8, 2961 & # x020132966. doi: 10.1073 / pnas.1814742116

Yang, C., Wang, Q., Liu, X., Cheng, X., Jiang, X., Zhang, Y., et al. (2016). NU7441 mejora la radiosensibilidad de las células de cáncer de hígado. Celda. Physiol. Bioquímica. 5, 1897 & # x020131905. doi: 10.1159 / 000445551

Yuzefovych, L. V., Kahn, A. G., Schuler, M. A., Eide, L., Arora, R., Wilson, G. L., et al. (2016). La reparación del ADN mitocondrial a través de la actividad de OGG1 atenúa la progresión y la metástasis del cáncer de mama. Cáncer Res. 1, 30 & # x0201334. doi: 10.1158 / 0008-5472.can-15-0692

Zhao, H., Wang, S., Song, C., Zha, Y. y Li, L. (2016). El valor pronóstico del estado del promotor MGMT por ensayo de pirosecuenciación para pacientes con glioblastoma & # x00027 supervivencia: un metanálisis. World J. Surg. Oncol. 1, 261. doi: 10.1186 / s12957-016-1012-4

Zhao, Q., Guan, J., Zhang, Z., Lv, J., Wang, Y., Liu, L., et al. (2017). La inhibición de Rad51 sensibiliza las células de cáncer de mama con PTEN de tipo salvaje a olaparib. Biomed. Farmacother. 165 & # x02013168. doi: 10.1016 / j.biopha.2017.07.090

Palabras clave: daño al ADN, vías de reparación del ADN, ADN mitocondrial, resistencia a los medicamentos, terapia del cáncer

Cita: Li L-y, Guan Y-d, Chen X-s, Yang J-m y Cheng Y (2021) Vías de reparación del ADN en la terapia y resistencia del cáncer. Parte delantera. Pharmacol. 11: 629266. doi: 10.3389 / fphar.2020.629266

Recibido: 14 de noviembre de 2020 Aceptado: 31 de diciembre de 2020
Publicado: 08 de febrero de 2021.

Zhe-Sheng Chen, St. John & # x02019s University, Estados Unidos

Dongmei Zhang, Universidad de Jinan, China
Guanghui Wang, Universidad de Xiamen, China

Copyright & # x000a9 2021 Li, Guan, Chen, Yang y Cheng. Este es un artículo de acceso abierto distribuido bajo los términos de la Licencia de atribución Creative Commons (CC BY). Se permite el uso, distribución o reproducción en otros foros, siempre que se acredite al autor (es) original (es) y al propietario (es) de los derechos de autor y se cite la publicación original en esta revista, de acuerdo con la práctica académica aceptada. No se permite ningún uso, distribución o reproducción que no cumpla con estos términos.


Topoisomerasa I frente a topoisomerasa II

Las topoisomerasas son las enzimas que participan en el enrollado o desenrollado del ADN. Alivian los superenrollamientos del ADN y facilitan la replicación y transcripción del ADN. Estas enzimas se pueden encontrar en casi todos los organismos, como humanos, bacterias, plantas superiores, otras bacterias y arqueas. Los reordenamientos topológicos del ADN se realizan mediante topoisomerasas. La hidrolización de ATP no es necesaria para la función de la topoisomerasa I. La topoisomerasa I corta una sola hebra en el ADN.Por otro lado, la topoisomerasa II corta ambas cadenas en el ADN y necesita ATP para su función o actividad. Más tarde, estos cortes en la columna vertebral del ADN se vuelven a sellar. Las topoisomerasas bacterianas y humanas tienen mecanismos similares en la naturaleza. Ésta es la diferencia entre la topoisomerasa I y II.

Descargue la versión PDF de Topoisomerase I vs II

Puede descargar la versión PDF de este artículo y utilizarla para fines sin conexión según la nota de citación. Descargue la versión PDF aquí Diferencia entre topoisomerasa I y II

Referencia:

1.Topoisomerasa I. Disponible aquí
2. "Topoisomerasa tipo II". Wikipedia, Wikimedia Foundation, 6 de noviembre de 2017. Disponible aquí
3. "Topoisomerasa tipo I". Wikipedia, Wikimedia Foundation, 28 de noviembre de 2017. Disponible aquí

Imagen de cortesía:

1. & # 8217 Inhibidor de topoisomerasa & # 8217 Por Vtvu & # 8211 Trabajo propio, (CC BY-SA 3.0) vía Commons Wikimedia
2. & # 82172rgr & # 8217 Por Coachwd en la Wikipedia en inglés, (CC BY-SA 3.0) a través de Commons Wikimedia


Ver el vídeo: En qué se diferencia el comportamiento de las células cancerosas del de las células sanas (Mayo 2022).