Información

¿Ultrasonido sin cavitación para la desnaturalización de hebras cortas de ADN (~ 20 pb)?

¿Ultrasonido sin cavitación para la desnaturalización de hebras cortas de ADN (~ 20 pb)?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Sé que existen investigaciones sobre burbujas de cavitación transitorias inducidas por ultrasonido que desnaturalizan mecánicamente el ADN al generar ondas de choque violentas localmente en la solución.

Me gustaría saber si es posible no cavitante ultrasonido para desnaturalizar hebras cortas de ADN, ~ 20 pares de bases de longitud (cite las fuentes, si es posible). El mecanismo debe ser mecánico, sin involucrar efectos térmicos o de cavitación de los ultrasonidos. El ultrasonido actúa como una onda de presión, del orden de 10 MPa, y las hélices de ADN requieren una fuerza de ~ 15 pN para iniciar la apertura. Solo necesito una prueba de que esto se ha demostrado con éxito.

Gracias de antemano.


Capítulo 4 - Enfoques de biología molecular utilizados en la genética preimplantacional: PCR en tiempo real, microarrays, secuenciación de próxima generación, cariomapeo y otros

En las últimas décadas, el desarrollo de nuevas tecnologías moleculares ha revolucionado el diagnóstico en el campo de la medicina reproductiva, con la evaluación de los dos factores principales involucrados en un embarazo exitoso: el embrión y el endometrio. La detección de embriones genéticamente anormales, así como la identificación de un endometrio óptimo mediante la transcriptómica se han convertido en una prioridad en los tratamientos de reproducción asistida para aumentar las tasas de embarazo. Este capítulo proporciona una descripción general de las técnicas moleculares empleadas actualmente en reproducción asistida para la evaluación de embriones, como pruebas genéticas preimplantacionales, cariotipo, hibridación fluorescente in situ, reacción en cadena de la polimerasa, matriz de hibridación genómica comparativa, matriz de polimorfismo de un solo nucleótido, cariomapping y próxima generación. secuenciación y para la evaluación del endometrio a través de la expresión génica: reacción en cadena de la polimerasa en tiempo real, microarrays de ADN y RNA-Seq. En cada sección, el lector encontrará una descripción detallada de los principios moleculares de cada técnica, junto con ejemplos de sus aplicaciones en la práctica clínica.


Abstracto

El síndrome de ovario poliquístico (SOP) es un trastorno multifactorial caracterizado por problemas menstruales irregulares, hiperandrogenismo y presencia de ovarios poliquísticos. Hasta la fecha, el mecanismo molecular subyacente al SOP sigue siendo difícil de alcanzar. Recientemente, se han identificado variantes del bucle de desplazamiento mitocondrial (bucle D) como nuevos actores en la patogénesis del SOP. En la actualidad, las variantes raras, además de las variantes comunes, también son objeto de investigación, ya que se cree que contribuyen de manera esencial al riesgo de enfermedades complejas. Sin embargo, las variantes hetroplasmáticas raras y bajas en el bucle D mitocondrial todavía no se investigan en mujeres con SOP. Además, las variantes en el origen de la replicación del ADN (OriL) de la hebra ligera del ADN mitocondrial (ADNmt) no se han explorado en el síndrome de ovario poliquístico. Por lo tanto, en este estudio, investigamos variantes de la región de OriL y del bucle D mitocondrial de raras a comunes obtenidas mediante la secuenciación de próxima generación de ADNmt en mujeres con SOP. Además, también evaluamos el número de copias de mtDNA, un biomarcador de disfunción mitocondrial (DM) en mujeres con SOP, ya que se sabe que las variantes en el mtDNA están asociadas con un bajo número de copias de mtDNA en mujeres con SOP. Se identificaron un total de 67 variantes de bucle D, incluidas 6 variantes novedosas, en 30 mujeres con SOP. Entre 67 variantes, se informaron 29 variantes en mujeres con SOP. Se encontró una sola variante, 5746A en la región OriL en dos mujeres con SOP. Se encontraron variantes de transición y transversión, pero las variantes de transición ocurren con una frecuencia muy alta en comparación con las transversiones (82,35% frente a 17,64%, respectivamente). Como se sabe que las variantes de transición en el mtDNA surgen debido a errores de la polimerasa γ, la aparición de altas tasas de transición indica que la mayoría de las mutaciones surgen debido a defectos en los errores de replicación que causan daño en el mtDNA que conduce a MD. Además, se encontró que el número de copias de mtDNA era bajo en mujeres con SOP en comparación con las mujeres de control sanas, lo que sugiere que la DM puede ser el factor contribuyente en la patogénesis del SOP.


Diagnóstico molecular final, final molecular

con respecto a las endonucleasas de restricción?
son enzimas producidas por bacterias para prevenir la invasión y replicación de ADN extraño en su genoma bacteriano.

¿Cuál de los siguientes aspectos de la medicina de laboratorio basada en la evidencia proporciona una estrategia transparente e imparcial en la búsqueda metódica de información sobre una prueba de laboratorio clínica específica?
revisión sistemática.

¿El aumento de la señal cuantificable observado desde el principio en la pcr en tiempo real depende de?
la cantidad inicial de ADN diana

Con VNTR y STR, es el ____ en una ubicación determinada en un individuo lo que varía para darle a una persona su ADN & quot; huella digital & quot
Numero de repeticiones

¿Qué afirmaciones describen mejor la relación entre la tipificación del ADN HLA y los halplotipos serológicos?
Se ven una o dos bandas para cada locus que se correlacionan con la reactividad con un antígeno específico o grupo de antígenos.

Un hombre de 20 años que padece distrofia muscular de Duchenne se empareja con una mujer que es portadora heterocigótica asintomática del trastorno. ¿Qué proporción de las hijas de esta pareja se verán afectadas?
50%

El personal médico de un departamento de emergencias le ha pedido que diseñe un analizador de mano en miniatura para el punto de atención que utiliza la detección de mutaciones mediante PCR para evaluar a los individuos en busca de alteraciones en las enzimas metabolizadoras de fármacos. Los requisitos de la muestra deben ser solo una cantidad de sangre de tubo capilar (punción digital) (0,5 ml). ¿Podrás diseñar un analizador de este tipo?
Sí, porque habrá una cantidad adecuada de glóbulos blancos para proporcionar suficiente ADN genómico para la detección por PCR.

¿Qué se puede hacer como paso inicial para reducir la interferencia de los ácidos nucleicos de las células sanguíneas antes de realizar un procedimiento de aislamiento de ácidos nucleicos circulantes?
Elija EDTA como anticoagulante al obtener una muestra de sangre

¿Qué vector requiere la clonación de un gen humano en una bacteria para hacer una sonda molecular grande?
Plásmido

La tasa de migración del ADN en una electroforesis en gel depende principalmente de la?
Tamaño del ADN genómico

El desarrollo de la tecnología de microarrays para su uso en el laboratorio clínico fue un desarrollo directo del deseo de?
Reducir los requisitos de volumen de muestra para la prueba.

¿Cuál es el propósito de la sonda de oligonucleótidos marcada que se usa en los ensayos de hibridación?
para detectar la presencia de una secuencia de nucleótidos específica

¿Cuál de los siguientes alelos tiene la frecuencia más alta en la población general?
mutación de metileno tetahidrofolato reductasa

el proceso de transferencia de ARN electroforesizado de un gel a una membrana especial de nailon se denomina?
transferencia del norte

un individuo que recibió terapia con medicamentos inmunosupresores para un trasplante de harina de maíz tuvo síntomas de enfermedad neurológica
ENFERMEDAD NEUROLÓGICA INDUCIDA POR VHS

El anticoagulante considerado el mejor para la extracción y evaluación de ADN genómico de muestras de sangre completa es
ácido citrato dextrosa y potasio EDTA

¿Cuál de las siguientes afirmaciones con respecto a la electroforesis en gel de ADN es correcta?
El gel de poliacrilamida se puede separar con moléculas de ADN más pequeñas de alta resolución de hasta 2 kb

¿Cuándo deben emplearse procedimientos para prevenir la contaminación de muestras de pacientes y reactivos con amplicones?
Todos los procedimientos anteriores se utilizan para prevenir la contaminación.

Un análisis de PCR de una muestra vaginal para Chlamydia Trachomatis da un resultado negativo en la densidad óptica del producto de reacción biotinilado por debajo del punto de corte. el resultado del control interno también está por debajo del límite. los controles positivos y negativos produjeron resultados aceptables. ¿Que acción se debería tomar?
el resultado no debe notificarse y la muestra debe notificarse

Un ácido nucleico es
ADN o ARN

El análisis y las cuantificaciones de la secuencia de pirosecuenciación dependen de la liberación de ___ en una cantidad igual a la de un dNTP incorporado.
Luciferasa

¿Cuál de las siguientes afirmaciones con respecto al análisis SSCP del polimorfismo conformacional monocatenario es incorrecta?
En SSCP, la separación de un producto de PCR se realiza con un gel de THt que incluye un gradiente de concentración de desnaturalizantes.

Dé un ejemplo de un trastorno que exhiba el patrón de herencia correctamente definido en la pregunta anterior.
Síndrome de Prader-willi PWS

¿Se hace referencia a la falta de síntomas de la enfermedad en un individuo y la disminución de la posibilidad de desarrollar una enfermedad a pesar de la presencia de la enfermedad específica que causa la mutación genética?
penetrancia reducida

¿Qué tipo básico de ensayo es la captura híbrida?
Hibridación

Se ha propuesto un estudio de investigación para la expresión génica de un subtipo de receptor de insulina. se le ha pedido que determine qué tipo de ácido nucleico debe utilizarse para el análisis. ¿Cuál de las siguientes muestras sería apropiada?
ARNm

La mayoría de los sistemas automatizados de aislamiento de ácidos nucleicos que se utilizan hoy en día utilizan ¿qué principio de técnica de aislamiento?
Fase sólida

después de la unión de varios cofactores a una hebra de ADN, la enzima requerida para que ocurra el proceso real de transcripción es?
ARN polimerasa II

¿Cuál de las siguientes afirmaciones sobre el ADN de las mitocondrias (ADNmt) es incorrecta?
la tasa de mutación del ADNmt es 20 veces menor que la del ADN nuclear

¿Cuál de las siguientes afirmaciones sobre el ADN miticondrial (ADNmt) es incorrecta?
la tasa de mutación del ADNmt es 20 veces menor que la del ADN nuclear

Refiérase a las siguientes secuencias de aminoácidos en las siguientes secuencias, la secuencia normal se da primero seguida de secuencias que son producidas por diferentes tipos de alteraciones de secuencia. Identifique el tipo de alteraciones de secuencia que probablemente causen cada secuencia de aminoácidos alterada.
normal: Phe Asn Pro Thr Arg
mutación 1: Phe Asn Pro
mutación 2: Phe Asn Ala Thr
mutación 3: Phe His Pro Thr Arg
¿Cuál es el tipo de alteración de secuencia que provocó la mutación 3?
equivocación

le preocupa que una prueba de ácido nucleico dé resultados negativos falsos debido a la presencia de inhibidores en una muestra. ¿Qué tipo de control podría incluir en su ensayo para determinar la presencia de inhibidores?
Adición al objetivo a una muestra alícuota

Con respecto a la genética molecular, el dogma central establece que?
los genes se perpetúan como secuencias de ácido nucleico pero funcionan expresándose en forma de proteína.

En los procedimientos de extracción de ARN actúan las sales de guanidinio?
lisar las células e inhibir la RNasa

¿Una ventaja de utilizar CVS de muestreo de vellosidades crónicas sobre la muestra de líquido amniótico para las pruebas de diagnóstico prenatal es esa?
Se puede obtener una muestra de CVS antes de la gestación.

Con respecto a los ensayos de carga viral del VIH, ¿cuál es la recomendación para informar los resultados al evaluar el cambio en la carga?
Como log10 copias / ml

al realizar una reacción de amplificación, ¿cuál es el mejor control que se puede ejecutar para verificar la presencia de un posible amplicón?
Control en blanco

Continuando con la pregunta anterior, un médico preguntará si los resultados del ensayo de carga viral predicen el resultado final de salud del paciente. ¿Un estudio para determinar esto se conoce como?
estudio de valor pronóstico

la transferencia de un patrón de una fotomáscara a la superficie de una oblea de silicona o plástico se denomina
fotolitografía

¿Un gen supresor de tumores?
todas las respuestas anteriores son correctas

En la evaluación del cáncer colorrectal, una prueba de detección diseñada con múltiples pares de cebadores de PCR que abarcan el gen de interés con cada par de cebadores con un cebador que incluye un promotor de ARN polimerasa y una secuencia de inicio de traducción con los amplicones resultantes incubados en un sistema de traducción. ¿es referido como?
prueba de truncamiento de proteínas

En el análisis de microarrays y maroarray, ¿qué moléculas están marcadas?
la muestra de ADN

¿Cuál de los siguientes sistemas de prueba se puede utilizar para ayudar en la identificación de un padre biológico de un niño determinado?
todas las respuestas anteriores son correctas

cuando una muestra de sangre se separa por centrifugación, el componente líquido se separa de las células. el suero es?
el componente líquido sin factores de coagulación en él

la herencia de dos copias de un gen alterado de un solo padre sin recibir el alelo normal del otro padre es?
disomía uniparental

Un hombre de 45 años acude a su médico con dificultad para hablar, torpeza, retorcimientos involuntarios de las extremidades superiores.
enfermedad de Huntington

para evitar un rendimiento mínimo de ADN o ARN circulante extraído con el uso de kits comerciales de extracción de ácido nucleico. puede ser necesario?
aumentar el volumen de muestra utilizada en el procedimiento de extracción

¿Qué término describe los productos producidos cuando el ADN es digerido por endonucleasas de restricción?
polimorfismos de longitud de los fragmentos de restricción

¿Cuáles de los siguientes parámetros se utilizan para controlar las células procesadas por el citómetro de flujo?
Dispersión de luz hacia adelante versus dispersión lateral

¿Cuál es el procedimiento correcto para la preparación de una muestra de líquido amniótico para la extracción de ADN genómico?
Prepare varios matraces de cultivo de tejidos T25 con el líquido e incube de 9 a 12 días.

realizará una técnica de hibridación y estará dispuesto a aceptar más desajustes de pares de bases al hibridar la sonda con su secuencia objetivo. cuál de las siguientes condiciones de reacción se utilizará.
alto contenido de sal, bajo en formamida, baja temperatura

¿Cuál es el método estándar de oro actual para la evaluación de la encefalitis por VHS por virus del herps simple en el líquido cefalorraquídeo del adulto?
PCR

En la reacción de terminación de la cadena de la secuencia de ADN. ¿Qué le falta al didesoxinucleótido (ddNTP) que evita que se una a otro nucleótido?
Un grupo hidroxilo en el carbono 3 '

En los métodos de PCR en tiempo real, ¿cómo se pueden identificar los productos de múltiples loci?
al etiquetar los cebadores e con flúores específicos

La heparina no es el anticoagulante ideal para las muestras de sangre que se utilizan para el aislamiento de ácidos nucleicos circulantes porque?
la integridad celular no se mantiene bien.

¿Cuál de los siguientes reactivos contiene la solución de mezcla maestra use9 ad en PCR?
Trifosfato de desoxirribonucleótido

¿Cuál es el método más común utilizado para las pruebas de paternidad en los EE. UU.?
análisis de repetición en tándem corto

La detección de ciertos enterovirus implica el uso de un ensayo NASBA de amplificación basado en secuencias de ácidos nucleicos para detectar ARN viral. Esta técnica muestra un significado de alta especificidad analítica?
que el ensayo detecta regiones únicas del ARN enteroviral con poca reactividad cruzada.

Si se va a utilizar ARN en un procedimiento de amplificación por PCR, ¿cuál es el paso inicial que se debe realizar?
Se debe realizar un procedimiento de transcripción inversa para formar ADNc.

¿Cuáles de las siguientes son características de un pedigrí recesivo ligado al cromosoma X?
generaciones pasadas a través de hembras portadoras no afectadas son comunes.

con respecto al ADN, un exón se define como?
segmento de ADN que se representa en una hebra madura de ARNm y se traduce en proteína.

¿Qué método de análisis de ADN se usa con más frecuencia para detectar el gen de la hemoglobina S?
PCR seguida de RFLP

La fusión de los cromosomas 9 y 22 que produce un híbrido BCR-ABL se produce en la LMC forma un cromosoma denominado
Cromosoma Filadelfia

¿Cuál de los siguientes NO es un componente de una auditoría clínica?
Evaluación del costo de enfoques alternativos que producen el mismo resultado.

¿Una ligasa es una enzima que?
reforma el enlace fosfodiéster entre ácidos nucleicos

¿Un organismo que crece rápidamente en cultivo es uno que es más adecuado para la detección e identificación de ácidos nucleicos?
Falso

Se realiza una reacción de PCR y los controles negativos demuestran la presencia de un número detectable de amplicones de productos de PCR. ¿Cuál es la causa más probable?
Contaminación de la muestra con trazas de ADN molde.

La presencia de una población clonal de linfocitos T de células pequeñas & lt10 ^ 4 en un paciente que se ha sometido a quimioterapia para tratar una neoplasia de células T se denomina?
enfermedad residual mínima

¿Qué afirmación describe con precisión la utilidad clínica de las pruebas de translocación en la leucemia?
la translocación es una forma sensible de identificar las células leucémicas supervivientes después del tratamiento.

¿Qué método se utiliza para determinar si el gen de la hemoglobina C está presente en las células fetales?
PCR seguida de transferencia con una sonda de oligonucleótidos específica.

Los ensayos que se utilizan para determinar la clonalidad de la población celular en la reordenación del gen del receptor de células T o inmunoglobulina y requieren menos ADN intacto que otros ensayos incluyen?
PCR

¿Por qué la concentración de analitos se considera una limitación en la aplicación clínica de la miniaturización?
Si el objetivo está presente en una concentración alta en un microlitro de muestra, entonces es apropiado para el análisis en un dispositivo de detección de microarrays.

¿Cuál de los siguientes tipos de mutación causa la terminación prematura de la síntesis de proteínas?
Disparates

Los tintes fluorescentes más conjugados con los anticuerpos utilizados en la citometría de flujo son?
Isotiocianato de ficoeritrina e fluoresceína

¿Una ventaja de los ensayos de genotipado sobre los ensayos de fenotipado para la evaluación farmacogenética sería?
que no están sujetos a la variabilidad interindividual debido a variaciones biológicas como la dieta, las hormonas, las fluctuaciones, etc.

¿La farmacogenética es?
el estudio de la variación genética en la reacción a un fármaco

¿La hemocromatosis hereditaria es el resultado de qué tipo de mutación?
sustitución de un solo nucleótido

¿Cuál de las siguientes enfermedades genéticas es causada por una repetición expandida de trinucleótidos?
Síndrome X frágil

¿Un SNP ES un?
Polimorfismo de nucleótido simple

Si se usa un hisopo para recolectar células bucales para la extracción de ADN. ¿Cuál es la mejor forma de transportar el hisopo al laboratorio?
sumergido en solución salina tampón

¿Cuál de los siguientes no se considera una diferencia entre los genomas bacterianos y humanos?
la presencia de ADN de doble estándar

¿Qué enunciado describe mejor el método de amplificación simple de ADN ramificado?
el ADN diana está unido por múltiples sondas, y estas se amplifican en lugar del ADN diana

qué declaración describe con precisión el proceso de hibridación fluorescente in situ (pez)
la hibridación se realiza directamente en el cromosoma intacto

Se recibe un nuevo analizador de carga viral en el laboratorio. Al analizar una muestra de control 50 veces y evaluar la media y la varianza del resultado, ¿está comprobando el_____ del instrumento?
Fiabilidad

¿Penetración reducida?
se observa en un individuo que tenía el genotipo de una enfermedad pero que puede no presentar el fenotipo de la enfermedad en absoluto.

¿Qué molécula de ADN bicatenario tiene la temperatura de fusión más alta?
un polímero de ADN de 100.000 pares de bases

¿El análisis de la presencia de ácidos nucleicos que se encuentran en la circulación sanguínea es importante en la monitorización?
todas las respuestas anteriores son correctas

Un valor A260 / A280 de 2.0 indica
ADN de alta calidad

en el linfoma folicular hay una gran cantidad de material genético extraído del cromosoma 14 que está adherido al cromosoma 18. ¿Esto se conoce como?
translocación

en exclusión de los requisitos de prueba de paternidad para que un individuo sea excluido como padre?
necesitan la ausencia de un alelo obligatorio para al menos dos loci en un individuo probado.

al realizar un procedimiento de PCR, ¿cuál es el mejor control para comprobar la presencia de amplicón?
Control bancario

en la evaluación de la sensibilidad clínica indica una tasa de sensibilidad baja?
aumento de falsos negativos

Transferir ARN (ARNt)
contiene la región anticodón que se une al codón del ARNm en el ribosoma

¿Cuál es el mejor método de recolección para la recuperación de células bucales?
enjuagar la cavidad bucal

Se sabe que el setenta y cinco por ciento de los casos de carcinoma de próstata involucran cuál de las siguientes anomalías moleculares o genéticas?
translocación cromosómica

el sitio de una secuencia de nucleótidos particular en un cromosoma se conoce como? lugar

¿Cómo se puede aplicar la PCR a la detección de la inmunodeficiencia humana y otros virus de ARN?
Adición de una enzima transcriptasa inversa estable en la cabeza a la mezcla maestra

¿Cuál es el uso de la prueba de carga viral para diagnosticar la infección aguda por VIH-1?
actualmente no aprobado por la FDA

La reacción en cadena de la polimerasa (PCR) involucra tres procesos. seleccione el orden en que ocurren?
Desnaturalización, recocido, extensión

¿El polimorfismo de los genes del citocromo 6450 es importante para identificar qué afección?
Mal metabolismo de los fármacos

¿Tamaño mínimo de función?
es la dimensión del componente más pequeño realmente construido en el proceso de fabricación de chips de computadora.

Con respecto a los SNP, una sustitución de bases que produce un codón de terminación (parada) inadecuado se denomina?
mutación sin sentido

Un estudio de investigación preparado para evaluar la precisión diagnóstica de una prueba de PCR para la clonalidad celular. El estudio fue defectuoso con un diseño deficiente. ¿Cuál de las siguientes afirmaciones son correctas?
error sistemático aumentado

al comparar el ADN de un presunto padre con el ADN de un niño, cuál de los siguientes polimorfismos tiene muchos alelos y un solo locus que puede tener una probabilidad superior al 90% de excluir a un padre acusado falsamente.

La pérdida de un gen que codifica una proteína supresora de tumores predispone a ciertas células a la transformación neoplásica y la proliferación descontrolada. Esta clase de alteración genética se conoce como?
Supresión

¿Cuál de las siguientes opciones no es una aplicación de un ensayo de carga viral?
evaluación de la resistencia a fármacos terapéuticos antivirales

un polimorfismo que consiste en una serie de repeticiones de trinucleótidos que tienen una longitud de 8 a 80 pares de bases y a veces se denomina secuencia de minisatélites se denomina?
número variable de repetición en tándem (VNTR)

¿Cuál es la diferencia entre un ensayo de ADN de microarrays y macroarrays?
la cantidad de cada objetivo es mayor en una macroarreglo

ha sido elegido para dirigir un laboratorio de farmacogenética en un hospital que atiende a muchos pacientes trasplantados que reciben derivados de mercaptopurina para controlar el rechazo. ¿Cuál de los siguientes ensayos de polimorfismo de enzimas sería de interés?
Fenotipado TPMT

con respecto a la farmacogenética, una enzima de fase I metaboliza fármacos por?
sustrato oxidante para hacerlo más soluble en agua antes de la execración

En la PCR, ¿cómo se logra la desnaturalización?
Calor

Los tiempos de respuesta son una consideración esencial en el desarrollo de un menú de pruebas para un laboratorio de diagnóstico molecular. Un tiempo de respuesta corto es importante, ¿pero también?
aumenta el costo analítico por muestra

¿Un ejemplo de una técnica de amplificación única en contraposición a una técnica de amplificación de diana sería?
detección de ADN de cadena ramificada

¿De qué se aisló la enzima bacteriana termoestable que permitió que los procedimientos de amplificación nucleica se convirtieran en procedimientos automatizados de rutina?
thermus aquatocus

¿Qué afirmación sobre la FQ es correcta?
Algunas mutaciones de la FQ pueden causar infertilidad masculina sin otros síntomas.

¿Cuál de las siguientes afirmaciones sobre la diferencia entre ADN y ARN es correcta?
El ARN existe típicamente como un polímero monocatenario que es mucho más corto que el ADN bicatenario.

en la reacción en cadena de la polimerasa PCR a ______ inicia la extensión de la secuencia de interés al permitir que la polimerasa Taq vea una sola hebra de ADN y comience a agregar nucleótidos?
Cebador

la principal diferencia entre el trabajo realizado en los laboratorios de investigación y los laboratorios clínicos es esa?
El trabajo de los laboratorios clínicos debe ser evaluado mediante medidas de control de calidad y garantía de calidad.

para que una población en proliferación de linfocitos T o B sea diagnosticada como neoplasia?
la clonalidad debe demostrarse mediante análisis de enzimas de restricción de la región variable del gen del receptor de células T o inmunoglobulina.

La heparina no es el anticoagulante ideal para la sangre que se utilizará para estudios de ADN porque?
interfiere con la reacción en cadena de la polimerasa

¿Cuál es la característica única de la ADN polimerasa Taq ADN polimerasa utilizada en la PCR?
es estable al calor

los cromosomas en una célula eucariota?
están en su estado más compacto y aparecen como estructuras en forma de dedos durante la etapa de división celular llamada metafase

¿Por qué mecanismo la herencia de las mutaciones BRCA1 o BRCA2 aumenta el riesgo de cáncer de mama y de ovario?
Función supresora de tumores deficiente

el proceso de transferencia de ADN de electroforesis digerido de un gel a una membrana de nailon se denomina?
Transferencia del sur

en los seres humanos, ¿qué componente de un gen se traduce en una proteína?
Exón

¿Cuál es el significado de la observación del ARNm circulante frente a la observación del ADN circulante?
La presencia de ARNm circulante indicó que se ha transcrito un mensaje y probablemente resultará en la síntesis de una nueva proteína.

A una mujer de 40 años se le diagnostica mieloma múltiple. Su médico recomienda ... STR loci ??
Los resultados que indican que una muestra es exclusivamente del donante a menudo se informan como un donante del 97% e indican un quimerismo estable

una población de células es positiva para los marcadores de superficie CD45, CD3, CD4 y Tdt. ¿Qué tipo de leucocitos son estos?
linfocitos

¿Cuál de las siguientes muestras tendría menos probabilidades de producir ADN nuclear?
células sanguíneas res purificadas

con respecto al síndrome de x frágil, una expansión de mutación completa significa que?
hay alelos con repeticiones CGG & gt200

¿En citometría de flujo se refiere el término puerta?
selección de subpoblaciones de células para contar

¿Un tema problemático con respecto al uso de grandes segmentos de ADN como muestra para la detección de microarrays es?
hibridación parcial

¿Cómo se puede explicar la proliferación celular por la translocación t de BCL2 (14:18) que ocurre en hasta el 90% de las personas con linfoma folicular de células B?
la transcripción del oncogén BCL2 aumenta con la translocación.

El ADN se reescribe en 3 tipos de ARN, cada uno con una tarea específica:
El ARN mensajero (ARNm) lleva el mensaje de la proteína al citoplasma.
El ARN ribosómico (ARNr) es la ubicación de la síntesis de proteínas.
El ARN de transferencia (ARNt) es responsable del transporte de aminoácidos.

¿Cuál de estas bases de nucleótidos está presente en el ADN pero se reemplaza por uracilo en el ARN?
Timina

Haga coincidir los siguientes términos con la respuesta más adecuada:
ADN: polímero de doble hebra que alberga información genética
ARN: polímero monocatenario que incorpora uracilo en lugar de timina.
Replicación: reproducción del ADN de la célula madre a la hija
Transcripción: mensaje de ARN creado a partir de ADN.
Traducción: información de ARN codificada en aminoácidos para la síntesis de proteínas

La secuencia de nucleótidos de tres bases que proporciona la información necesaria para identificar un aminoácido se denomina un (a):
Codón

¿Cuáles de los siguientes son ejemplos de variables preanalíticas que afectan las metodologías moleculares?
Identificación adecuada del paciente
Almacenamiento adecuado
Uso correcto de anticoagulantes

Al recolectar muestras de sangre, un anticoagulante que se debe evitar, especialmente cuando se realiza una PCR, es:
Heparina

Los objetivos de interés pueden incluir:
Bacterias
ARN
ADN

¿Cuál de los siguientes no es un ejemplo de método de amplificación?
PEZ

Haga coincidir las siguientes técnicas de detección con la descripción más adecuada:
Fluorescencia:
Emisión de luz a una longitud de onda más larga cuando se excita a una longitud de onda más corta
Quimioluminiscencia:
Energía luminosa como resultado de una reacción química.
Enzima: se puede usar en combinación con fluorescencia o con un tinte
Electroforesis:
Movimiento por corriente eléctrica en una matriz de gel.

¿Cuál de los siguientes pasos no se incluye en una prueba de ácido nucleico directa?
Amplificación

Haga coincidir las siguientes pruebas con su principio apropiado:
PEZ
Prueba de ácido nucleico directo que comúnmente utiliza tinción específica de secuencias de ADN mediante una sonda de ADN o ARN marcada con fluorescencia.
bADN
Prueba de amplificación de señal que utiliza amplificación de señal y fosfatasa alcalina
PCR
Prueba de amplificación de diana que utiliza ciclos térmicos y ADN polimerasa
LCR
Prueba de amplificación de la diana utilizando ciclos térmicos y ADN ligasa
TMA
Amplificación del objetivo utilizando transcriptasa inversa pero sin ciclos térmicos

¿Cuál es el nombre de la alteración del ácido nucleico de sustitución que provoca la codificación de un aminoácido diferente?
Sin sentido

¿Cuáles de las siguientes opciones se consideran ventajas de las pruebas moleculares?
Mayor sensibilidad
El tiempo de respuesta es más rápido que para los métodos de cultivo.

El producto producido en amplificación se denomina:
Amplicón

Haga coincidir los siguientes procesos con la respuesta correcta:
Replicación
Transferencia de ADN hereditario de las células parentales a las hijas
Traducción
La formación de una proteína a partir de ARNm.
Transcripción
El proceso de transferir información del ADN a un mensaje de ARN.

El apareamiento o hibridación de dos hebras de ADN se denomina:
Hibridación

¿Cuál de las siguientes afirmaciones es correcta con respecto a las variables preanalíticas?
Debe evitarse la heparina como anticoagulante para los métodos de PCR.

La aplicación de métodos moleculares puede incluir:
Identificación de enfermedades infecciosas
Farmacogenética
Detección de marcadores tumorales
***Todo lo anterior

Un ácido nucleico utilizado para identificar una diana de hibridación se denomina: Sonda

Una desventaja de utilizar un método de amplificación de ácidos nucleicos es: Necesidad de un espacio de laboratorio dedicado

Haga coincidir los siguientes ARN con la declaración más adecuada:
ARNt
Responsable del transporte de aminoácidos
ARNr
Parte del ribosoma responsable de la síntesis de proteínas.
ARNm
Lleva el mensaje de proteínas al citoplasma.

Haga coincidir los siguientes principios de prueba con la respuesta más adecuada:
PEZ
Detecta objetivos en muestras de citología / histología
RFLP
Corta ADN largo en fragmentos más cortos para detectar polimorfismos
Southern Blot
Utiliza enzima endonucleasa de restricción y electroforesis en gel

Algunos aminoácidos tienen más de un codón para dirigir su ubicación, esto se denomina:
Degeneración

¿Cuál de las siguientes no es una enzima que se utiliza en los métodos de amplificación molecular?
Amilasa

¿Cuál de los siguientes no es un nucleótido en el ARN?
Timina

¿Cuál de los siguientes factores ambientales puede provocar la separación de cadenas de ácidos nucleicos?
Aumento de temperatura

¿Cuál de las siguientes es una prueba de ácido nucleico directa?
PEZ

Haga coincidir los siguientes principios de prueba con la respuesta más adecuada:
bADN
Amplificación de señal con fosfatasa alcalina y sin ciclos térmicos
TMA
Amplificación de diana mediante transcriptasa inversa. No se necesitan ciclos térmicos
PCR
Amplificación del objetivo mediante ADN polimerasa y ciclos térmicos.
NASBA
Amplificación del objetivo utilizando 3 enzimas y sin ciclos térmicos

Haga coincidir los siguientes métodos de detección con la respuesta más adecuada:
Enzima
Se puede combinar con fluorescencia o tintes y utiliza reacciones químicas estándar.
Fluorescencia
Las moléculas emiten luz a una longitud de onda más larga cuando se excitan a una longitud de onda más corta y pueden teñirse y etiquetarse.
Quimioluminiscencia
Liberación de energía luminosa como producto de una reacción química.
Radioactividad
Utiliza un contador de centelleo para detectar la descomposición
Electroforesis
Movimiento en una matriz de gel causado por un campo eléctrico.

En un método de amplificación por PCR, ¿cuál de los siguientes se amplifica?
Objetivo

Haga coincidir las siguientes alteraciones con la respuesta más adecuada:
Sin sentido
Un nucleótido o sustitución de secuencia que codifica un aminoácido diferente.
SNP
Alteración más común Un solo cambio de base
Supresión
Falta un nucleótido u otra parte de la secuencia de ADN
Inserción
Un nucleótido de ADN adicional u otra porción de la secuencia de ADN
Disparates
Una subestación de nucleótidos que termina en la terminación temprana del proceso de fabricación de proteínas, generalmente debido a un codón de parada.

las unidades protectoras de secuencia repetida en los extremos de los cromosomas tienden a disminuir en las células somáticas después de una serie de eventos de replicación; sin embargo, en las células malignas y la enzima mantiene el extremo cromosómico que perpetra la vida celular. esta enzima se conoce como?
telomerasa

NDIS es un /
sistema de perfiles de ADN utilizado en las pruebas de identidad forense que utiliza y compara 13 secuencias repetidas en tándem cortos de núcleo.

¿Cuál de los siguientes es el tipo de polimorfismo más común?
polimorfismo de un solo nucleótido (SNP)

ESTÁNDAR
es un proyecto diseñado para mejorar la calidad de informar el resultado de los estudios de precisión diagnóstica

¿La vía que conduce al cáncer colorrectal que implica un error de replicación del ADN principalmente dentro de las repeticiones de microsatélites o secuencias repetitivas que permanecen sin corregir es el?
Vía de inestabilidad de microsatélites

¿Qué proceso se puede utilizar para hacer que una sonda de ADN produzca una señal fluorescente o quimioluminiscente?
sustitución de nucleótidos biotinilados o fluorescentes en la sonda.

¿Cuál de las siguientes secuencias indicaría que debe detenerse la traducción de una proteína que se está sintetizando?
5 'AAC CGA CUC AUC CAG GUA UAG3'

T amplificar todos los alelos en un análisis de locus HLA diana ¿La secuencia que se amplificará mediante PCR está definida por el ____ utilizado en la reacción?
pares de cebadores

Ciertos genes se utilizan como marcadores para la identificación del sexo de un individuo, como el gen de la amelogenina. ¿Cuál de los siguientes también es útil como marcador de sexo?
Marcadores polimórficos del cromosoma Y

¿Cuáles de las siguientes características son comunes tanto al ARN como al ADN?
Consiste en un residuo de azúcar, fosfato y una base de purina o pirimidina.
Unido por enlaces fosfodiéster.

La cadena de ADN que termina con un grupo fosfato es el extremo 5 '.
cierto

Existen varios métodos para extraer ácidos nucleicos (ADN y / o ARN>) de las muestras. Los protocolos más comunes son manuales o automatizados, que esencialmente tienen los mismos principios. Coloque cada principio en orden:
Lisis de material de muestra. Se liberan ácidos nucleicos y se desnaturalizan las nucleasas.
Unión de ácidos nucleicos a la superficie de una membrana, como los silicatos. Esta unión se ve facilitada por las condiciones de la sal caotrópica y la alta fuerza iónica del tampón de lisis / unión.
Separación del ácido nucleico unido a la membrana de la muestra residual lisada.
Eliminación de sustancias no unidas (proteínas, restos celulares e inhibidores de la PCR) mediante varios pasos de lavado.
Elución de ácido nucleico purificado de la membrana.

¿Cuál es el primer paso de la reacción de PCR?
Desnaturalización

¿Durante qué fase de la PCR en tiempo real se puede empezar a registrar la señal fluorescente?
Fase exponencial

Una de las mejores formas de evaluar el polimorfismo de un solo nucleótido (SNP) es mediante el análisis de la curva de fusión
cierto

¿Qué no es una aplicación de PCR en tiempo real?
Amplificación de ADN para transferencia Northern

Las tres formas funcionales principales de ARN incluyen:
ARN mensajero
ARN ribosómico
Transferencia de ARN

¿Cuál es la característica clave de la PCR en tiempo real que no está disponible con la PCR estándar o convencional?
La amplificación del ADN se puede detectar a medida que avanza la PCR.

¿Cuáles de las siguientes afirmaciones son verdaderas en relación con los tintes no específicos utilizados para la detección en el procedimiento de RT-PCR? Más de una respuesta puede ser correcta.
* Estos tintes son fluorescentes y se unen a todas las piezas de ADN de doble hebra.
* SYBR green es un ejemplo de tinte no específico.
* Los tintes no específicos pueden causar una cuantificación inexacta.

Durante cada ciclo de la PCR, el ADN se duplica y da como resultado la acumulación exponencial del fragmento de ADN objetivo.
cierto

Los termocicladores son instrumentos que se utilizan para amplificar muestras de ADN y ARN mediante la reacción en cadena de la polimerasa.
cierto

¿Cuál de las siguientes afirmaciones sobre la PCR con transcriptasa inversa es verdadera?
* Utiliza una enzima transcriptasa inversa (RTE).
* Crea una copia de ADN utilizando la muestra de ARN original.
* Evaluar la progresión de la replicación viral en pacientes con VIH.

Evaluar la progresión de la replicación viral en pacientes con VIH.
La multiplexación es el proceso de PCR que consiste en analizar varias secuencias diana diferentes de ADN o ARN simultáneamente en la misma muestra.
cierto

¿Cuáles son los usos más comunes del análisis de PCR en tiempo real para la detección de carga viral?
* Para monitorear infecciones en pacientes trasplantados.
* Evaluar la progresión de la replicación viral en pacientes con VIH.

¿Qué temperatura se considera óptima para la actividad de la polimerasa Taq?
72 ° C

El ácido desoxirribonucleico (ADN) se compone de:
Adenina
Guanina
Citosina
Timina

Haga coincidir los nombres de las etapas de PCR con sus definiciones.
* El ADN se calienta para romper los enlaces de hidrógeno dando como resultado un ADN monocatenario.
Desnaturalización
* Los cebadores de ADN se adhieren a las cadenas de ADN.
Recocido
* La ADN polimerasa sintetiza nuevas hebras de ADN.
Extensión

En la PCR en tiempo real, el análisis de la curva de fusión es tan sensible que se puede utilizar para detectar un polimorfismo de un solo nucleótido (SNP) o una diferencia de un solo nucleótido en las moléculas de ADN.
cierto

Clínicamente, determinar la carga viral es cómo se identificaría el genotipo específico en las infecciones por VIH.
falso

El valor del umbral del ciclo (Ct) está asociado con la cantidad de producto de PCR en la reacción. ¿Cuales de las siguientes son correctas?
Cts & lt 29 son reacciones positivas fuertes indicativas de abundante ácido nucleico diana en la muestra.
Ct de 30-37 son reacciones positivas indicativas de cantidades moderadas de ácido nucleico diana.
Ct de 38-40 son reacciones débiles indicativas de cantidades mínimas de ácido nucleico diana.

¿Cuál de los siguientes es el aspecto MÁS importante sobre la hibridación en los procedimientos de PCR?
La hibridación se produce cuando la temperatura de la mezcla de reacción se enfría a 50-60 ° C durante 20-40 segundos.

El extremo 5 'de una cadena de ADN termina con un grupo OH.
falso

Haga coincidir cada característica enumerada a continuación con la PCR convencional o en tiempo real.
*PCR en tiempo real
Mide el producto de PCR durante todo el proceso de amplificación
* PCR convencional
Requiere varios pasos que pueden provocar contaminación
* PCR convencional
Es seguido más comúnmente por electroforesis en gel de agarosa.
*PCR en tiempo real
Todos los ciclos, incluida la detección, se pueden completar en el mismo tubo.

Todo lo siguiente es cierto acerca de la principal ventaja de la extracción automatizada frente a la extracción manual EXCEPTO:
Es menos costoso pero más difícil de realizar con un mayor riesgo de contaminación.

Los resultados de la PCR en tiempo real se muestran comúnmente en un gráfico de amplificación. ¿Cuál de las siguientes opciones describe la progresión de las fases de la gráfica de amplificación?
Línea de base estacionaria, exponencial, meseta

Al final de una fase de Síntesis (S) exitosa, los cromosomas de la célula son ______.
Doblado

Para iniciar la fase Gap 1 (G1) del ciclo celular, se requieren _______.
Factores de crecimiento

El punto de control celular que bloquea la transición de G1 a S se llama ______.
Proteína del retinoblastoma (Rb)

Los oncogenes se definen como genes capaces de transformar células sanas en células cancerosas. Identifique oncogén (s) de las siguientes opciones:
ERK
Ras
Raf
*Todo lo anterior

Afatinib, Erlotinib y Gifitinib son inhibidores de moléculas pequeñas que se dirigen al cáncer de pulmón de células no pequeñas positivo para la mutación _______.
EGFR

______ es una molécula compleja en el sentido de que es antiproliferativo en células sanas, por el contrario, en las células cancerosas, especialmente el cáncer en etapa tardía, promueve la proliferación celular.
TGFB

Las características que caracterizan la apoptosis incluyen ___________.
Contracción del tamaño total de la celda
Ampollas en la membrana celular
Condensación cromosómica seguida de colapso del núcleo celular
*Todo lo anterior

Las células cancerosas se habilitan con un potencial de crecimiento ilimitado al activar una proteína llamada _______ para extender la vida útil de los telómeros.
Telomerasa

El proceso de división celular generalmente se ralentiza después de aproximadamente _____ rondas de divisiones.
50

Las células cancerosas migran a los tejidos sanos adyacentes y a los órganos distales a través de _____.
Metástasis

Opdivo y Keytruda son dos medicamentos aprobados por la FDA que permiten la activación de _______ bloqueando PD-1.
Células T citotóxicas

Cada molécula de glucosa se puede convertir para generar ______ moléculas de ATP como combustible celular.
32

_______ son capaces de engullir e ingerir células no deseadas, como células infectadas o células cancerosas.
Macrófago

Las células normales generan _____ moléculas de ATP al descomponer una molécula de glucosa en marcado contraste, las células cancerosas solo producen _____ de ATP al descomponer una molécula de glucosa.
32 . 2

Existen múltiples tipos de células en el microambiente tumoral. Éstos incluyen:
Células tumorales
CAF (fibroblastos activados por cáncer)
TAM (macrófagos activados por tumores)
*Todo lo anterior

El desarrollo del tumor sigue un proceso progresivo que se describe como:
Normal - & gt Hiperplasia - & gt Displasia - & gt Carcinoma in situ - & gt Malignidad

Los medicamentos huérfanos se refieren a:
Medicamentos que tratan trastornos raros.

Según el estudio de la Clínica Mayo, la aspirina a _____ mg por día durante dos años muestra una reducción del cáncer colorrectal en un 60%.
600

Se observa que _____ es antiproliferativo además de regular la respuesta inmunitaria en condiciones saludables. Por el contrario, en la malignidad, _____ promueve el crecimiento de células cancerosas y la metástasis.
TGFB

Después de que una célula ha pasado por ocho rondas de división celular, la población celular se convierte en ______.
256

Al final de la fase M del ciclo celular, una madre se convierte en _____ células hijas con información genética idéntica.
2

Las células cancerosas aumentan los niveles de glucosa intracelular al generar más:
Proteínas transportadoras de glucosa

Las células cancerosas se inmortalizan al producir ______ para proteger los telómeros.
Telomerasa

Un medicamento genérico que alivia el dolor y la fiebre además de reducir los coágulos de sangre, _____ es una gran historia de éxito en la reutilización de medicamentos porque ralentiza el crecimiento de las células cancerosas.
Aspirina

Las células cancerosas crecen incontrolablemente debido a:
Mutación e inactivación de genes supresores de tumores
Mutación y sobreactivación de oncogenes
Evadir la vigilancia inmunológica
*Todo lo anterior

Las células inmunes capaces de fagocitosis incluyen:
Macrófagos

Identifique el fármaco aprobado por la FDA que se utiliza en la oncoinmunoterapia:
Keytruda

Identifique un oncogén mutado con frecuencia que se encuentra en el cáncer de pulmón de células no pequeñas (CPCNP) y otros tipos de cáncer:
EGFR

Identifique un oncogén mutado con frecuencia que se encuentra en el cáncer de pulmón de células no pequeñas (CPCNP) y otros tipos de cáncer:
Tipos 16, 18, 59, 68

Seleccione la declaración que describa correctamente el genoma del VPH y sus proteínas codificadas.
La proteína codificada por el virus E7 interactúa con la proteína intracelular Rb del hospedador

La mayoría de los condilomas genitales y las lesiones cervicales causadas por el VPH se resuelven como resultado de la respuesta inmunitaria del individuo infectado.
CIERTO

¿Qué tipos de virus del VPH no causan cáncer pero pueden representar el 90% de todas las verrugas genitales?
Tipos de VPH de bajo riesgo 6 y 11

La infección por VPH puede persistir durante años en las células del cuello uterino y eventualmente convertir las células normales en células malignas.
CIERTO

¿Qué gen o genes del VPH controlan la producción de E6 y E7 en el ciclo de vida viral normal?
El gen E2

_____________ es un procedimiento de diagnóstico que examina una vista ampliada e iluminada del cuello uterino, la vagina y la vulva, generalmente cuando se encuentra una anomalía en una prueba de Papanicolaou y requiere un examen más detenido.
colposcopia

Revise las descripciones de las técnicas de prueba molecular y seleccione las declaraciones correctas.
* Los ensayos de amplificación de diana utilizan métodos para hacer más copias de una región específica de ADN.
* La desnaturalización es el proceso de convertir el ADN de doble hebra en ADN de una sola hebra.

Se analizaron veinticinco muestras de ADN aislado de muestras de citología cervical líquida, un control negativo y un control positivo con el ensayo de ADN de HC 2 de alto riesgo. Todas las muestras de pacientes y ambos controles fueron positivos para los tipos de VPH-AR.
Omisión del paso de lavado

La FDA otorgó a la prueba cobas HPV la primera aprobación de la FDA para HPV para el uso ampliado de la prueba para incluir su uso como prueba conjunta o como prueba primaria de detección de cáncer de cuello uterino.
CIERTO

La prueba Cervista HPV está aprobada por la FDA y está disponible en dos pruebas (1) una prueba de detección de HPV para 14 tipos de HPV HR y (2) una prueba de HPV para los tipos 16 y 18 de HPV.
CIERTO

En las pruebas de diagnóstico molecular, la hibridación emplea la unión de pares de bases complementarios de una hebra sintética a ADN o ARN.
CIERTO

En una infección por VPH, ¿dónde se replica el ADN viral?
En células epiteliales escamosas

En el ciclo de vida de una infección por VPH genital humano, ¿en cuál de los siguientes casos el cuerpo puede eliminar la infección?
Cuando la infección está en las células epiteliales escamosas de la superficie o cuando la infección se ha vuelto productiva en las capas inferiores de las células epiteliales escamosas.

¿Qué prueba de VPH aprobada por la FDA, basada en dos procesos principales 1) preparación automatizada de muestras para extraer simultáneamente el VPH y el ADN celular y (2) la amplificación por PCR de las secuencias de ADN diana, ha recibido la aprobación ampliada de la FDA para su uso como una prueba conjunta o como ¿una prueba de detección primaria de cáncer de cuello uterino?
Prueba de VPH Cobas

¿Cuáles de las siguientes afirmaciones son verdaderas al describir las pautas actualizadas de detección del cáncer de cuello uterino de 2018? (Más de una opción puede ser correcta).
Las mujeres menores de 21 años no deben someterse a pruebas de detección de cáncer de cuello uterino. Sin embargo, se recomienda el cribado con la prueba de Papanicolaou una vez que la mujer se vuelve sexualmente activa.
Las mujeres de 21 a 29 años deben someterse a pruebas de detección cada 3 años mediante una prueba de Papanicolaou o una citología líquida, pero no con la prueba del VPH.
En 2018, la USPSTF recomendó usar la prueba del VPH (hrHPV) como una opción como prueba de detección primaria para mujeres de 30 a 65 años.
Como opción, las mujeres de 30 a 65 años pueden someterse a pruebas conjuntas con las pruebas de VPH y Papanicolaou cada cinco años.

¿Cuál de los siguientes genes INICIA la síntesis de ADN, promueve la división celular e inhibe la muerte celular?
Protooncogenes

¿Qué se utiliza en muchos ensayos moleculares para permitir la detección de la diana o para asegurar copias adecuadas de la diana?
Amplificación

Las definiciones que se enumeran a continuación definen los términos que se utilizan en las pruebas moleculares. Haga coincidir cada definición con el término del cuadro desplegable que define.
Oligonucleótido: una hebra sintética corta de ácido nucleico
Sonda: un fragmento de ácido nucleico que es complementario a otra secuencia de ácido nucleico que se marca y se utiliza para identificar la secuencia complementaria.
Objetivo: una región específica de ADN o ARN exclusiva del organismo, mutación o enfermedad que se detecta mediante el método de prueba molecular.

Las proteínas codificadas por HPV E6 y E7 son importantes por cuál de las siguientes razones?
Convierten las células huésped normales en células malignas.

El virus del papiloma humano (VPH) es una infección rara que ocurre con poca frecuencia y que siempre progresa a un estado patológico.
FALSO

¿Cuál de los siguientes está asociado con un mayor riesgo de desarrollar cáncer de cuello uterino si una mujer está infectada con el virus del VPH?
DE FUMAR

Desnaturalización: primero, la mezcla de reacción que contiene la plantilla de ADN se calienta para desnaturalizar o separar el ADN de doble hebra en hebras simples.
Recocido: la mezcla de reacción se enfría luego para permitir que los cebadores se hibriden o se unan a la plantilla de ADN.
Extensión: por último, la polimerasa comienza a sintetizar nuevas hebras de ADN, a partir de los cebadores (extensión.

Una reacción de PCR básica funciona de la siguiente manera:
Primero, dos secuencias cortas de ADN llamadas cebadores están diseñadas para unirse al inicio (3 ') y al final (5') del ADN diana. Las secuencias de ácido nucleico del cebador se eligen para flanquear la región diana, de modo que en la amplificación la diana aumenta.
Para realizar la PCR, la plantilla de ADN que contiene la diana se agrega a un tubo que contiene cebadores, nucleótidos libres (adenina, guanina, citosina, timina), [estos también se conocen como trifosfatos de desoxirribonucleótidos (dNTP)] y una enzima llamada ADN polimerasa.
Esta mezcla se coloca en una máquina de PCR. La máquina de PCR aumenta y disminuye la temperatura de la muestra en pasos automáticos programados.
Inicialmente, la mezcla se calienta (por ejemplo, 95 ° C) para desnaturalizar o separar la plantilla de ADN de doble hebra en hebras simples. A continuación, la mezcla se enfría (por ejemplo, 60-65 ° C) de modo que los cebadores se hibridan (se unan) al molde de ADN.
Finalmente, la temperatura se aumenta a aproximadamente 72 ° C para optimizar la ADN polimerasa, catalizando la adición de nucleótidos para sintetizar nuevas hebras de ADN a partir de los cebadores (extensión). Al final del primer ciclo, cada molécula de ADN de doble hebra consta de una hebra de ADN nueva y una antigua.
Luego, la PCR continúa con ciclos adicionales que repiten los pasos antes mencionados. Los segmentos de ADN recién sintetizados sirven como plantillas en ciclos posteriores, lo que permite que el ADN objetivo se amplifique exponencialmente millones de veces.

¿Cuáles son los pasos secuenciales de una reacción de PCR?
Desnaturalización: primero, la mezcla de reacción que contiene la plantilla de ADN se calienta para desnaturalizar o separar el ADN de doble hebra en hebras simples.
Recocido: la mezcla de reacción se enfría luego para permitir que los cebadores se hibriden o se unan a la plantilla de ADN.
Extensión: Por último, la polimerasa comienza a sintetizar nuevas hebras de ADN a partir de los cebadores (extensión).

Si una célula B inmadura se expone a un antígeno, los genes de la cadena pesada pueden reorganizarse para producir moléculas de anticuerpos específicas. esto se conoce como?
hipermutaciones somáticas

Se utiliza un ensayo de PCR multiplex para detectar una secuencia diana de ADN o ARN. Este ensayo podría usarse para detectar un virus o bacteria específicos o determinar si un individuo tiene un gen de interés.
FASE

Los ensayos de PCR multiplex generalmente tardan más en producir resultados que los métodos de cultivo convencionales.
FASE

Dado que los cebadores son el factor determinante de qué región del ADN se amplificará mediante PCR, el cebador no debe ser específico del objetivo.
FASE

¿De cuántos pares de bases (pb) generalmente constan los cebadores?
18-22 pb

La temperatura de fusión (Tm) es la temperatura a la que el ADN se desintegra en sus nucleótidos separados.
FASE

Verificación es el término utilizado cuando se trata de un ensayo aprobado por la FDA sin modificar.
Validación es el término utilizado cuando se trata de un ensayo no aprobado por la FDA (prueba desarrollada en laboratorio [LDT])

Recolección de muestras: asegúrese de que se procese una muestra representativa y validada y que estén presentes abundantes ácidos nucleicos.
Transporte: asegúrese de que existe un sistema para mantener la estabilidad de los ácidos nucleicos (por ejemplo, en hielo o con medios estabilizados con ARN cuando sea apropiado).
Almacenamiento: si la muestra no se procesa de inmediato, el almacenamiento se realiza con mayor frecuencia a -80 ° C.
Procesamiento de la muestra: Siga las precauciones estándar.
Extracción de ácidos nucleicos: cuando corresponda, utilice extracción manual o automatizada.
Contaminación: Evite la contaminación al tener un entorno apropiado que optimice la contención y se adhiera a la descontaminación posterior al procesamiento (por ejemplo, etanol y lejía).

Precisión: ¿puede coincidir con las afirmaciones del fabricante? Utilice calibradores / material de calibración y control de calidad disponibles con valores conocidos, material de ensayo de aptitud con valores conocidos y muestras previamente analizadas con valores conocidos. Generalmente, 10 muestras positivas y diez negativas son suficientes para establecer la precisión.
Precisión: ¿puede el laboratorio analizar repetidamente las mismas muestras en tres días diferentes con tres operadores diferentes (tecnólogos) y obtener resultados iguales o comparables?
Rango notificable: ¿qué tan altos y bajos se pueden determinar con precisión los resultados de las pruebas? En general, seleccione muestras con valores conocidos según la afirmación de precisión del fabricante más alta y más baja. Los resultados solo se pueden informar para este rango.

La precisión es la correlación entre los resultados de la PCR y los resultados de referencia positivos "conocidos". Estos pueden obtenerse comercialmente (con certificados de análisis) o muestras obtenidas de laboratorios de referencia o colegas que realizan los mismos ensayos. Es importante probar distintos niveles de los objetivos.
La precisión de un procedimiento analítico es la correlación de concordancia entre una serie de mediciones obtenidas a partir de muestreos múltiples de la muestra homogénea realizada en las condiciones exactas del ensayo. Hay tres niveles de precisión, que incluyen:
Repetibilidad: expresa la precisión en las mismas condiciones de funcionamiento durante un breve intervalo de tiempo. La repetibilidad también se denomina precisión intraensayo.
Precisión intermedia: expresa variaciones dentro de los laboratorios (por ejemplo, diferentes días, diferentes analistas, diferentes equipos, etc.).
Reproducibilidad: Expresa la precisión entre laboratorios (estudios colaborativos generalmente aplicados a la estandarización de la metodología).

Haga coincidir las siguientes definiciones de los parámetros de validación del ensayo con los parámetros que definen.
* Precisión: Correlación de acuerdo entre una serie de medidas obtenidas a partir de muestreos múltiples de la muestra homogénea realizada bajo las condiciones exactas del ensayo.
* Especificidad clínica: capacidad de un ensayo para dar un resultado NEGATIVO para pacientes que no tienen la enfermedad / parámetro de prueba en cuestión.
* Sensibilidad clínica: capacidad de un ensayo para dar un resultado POSITIVO para pacientes que tienen la enfermedad / parámetro de prueba en cuestión.
* Precisión: correlación entre los resultados de la PCR y los resultados de referencia positivos CONOCIDOS.
* Objetivos: componentes de nucleótidos calculados para identificar secuencias de genes específicas.

Todos los cebadores tienen la misma temperatura de fusión.
FALSO

¿Cómo se llama el proceso de varias etapas que evalúa la idoneidad de un ensayo para el propósito previsto?
Validación

¿Cuál es el objetivo de una reacción de PCR?
ADN bicatenario

Se ha documentado que el beneficio de los paneles respiratorios del ensayo de PCR múltiple para los pacientes:
Disminuya la duración del uso de antibióticos.
Reducir la duración de la estancia hospitalaria.
Disminución del tiempo de aislamiento.

Los paneles gastrointestinales (GI) que utilizan un ensayo de PCR multiplex ofrecen la detección y diferenciación de agentes infecciosos bacterianos, virales y parasitarios en cuestión de horas.
CIERTO

¿Cómo se define la especificidad analítica?
La capacidad de un ensayo para detectar el objetivo deseado.

¿Cuál es la enzima clave necesaria para la replicación del ADN?
ADN polimerasa

Al diseñar y elegir cebadores para ensayos multiplex, es importante tener en cuenta lo siguiente:
Diseño de imprimación
Temperatura de recocido de la imprimación
Concentración de cebador
Concentración de dNTP, cloruro de magnesio (MgCl2), polimerasa y sales

¿Cuál es la temperatura ideal para la ADN polimerasa Taq?
72 ° C

¿Cuáles son los tres pasos básicos de un ciclo de PCR convencional?
Desnaturalización, recocido y extensión.

¿Cuál es sinónimo de límite de detección?
Sensibilidad analítica

Si una muestra no se puede procesar inmediatamente, ¿cuál es la MEJOR temperatura para almacenar la muestra?
-80ºC

¿Cuál es el orden correcto para validar un ensayo de PCR multiplex?
Definir objetivos, sensibilidad analítica, especificidad analítica, exactitud, precisión

Uno de los aspectos más desafiantes de la implementación de un ensayo de PCR multiplex es obtener material de control adecuado para el proceso de verificación y validación. Estos se pueden obtener de todos los siguientes EXCEPTO:
Valores desconocidos de muestras de pacientes

Se utiliza una PCR multiplex para detectar dos o más secuencias diana de ADN o ARN con amplificación en un solo tubo de reacción. Se agregan múltiples conjuntos de cebadores y sondas a la reacción, lo que permite detectar más dianas en una sola ejecución.
CIERTO

La fórmula de la temperatura de fusión del cebador (Tm) es: Tm = 4 (G + C) + 2 (A + T)
¿Cuál es la temperatura de fusión del cebador de PCR, 5'-AATCCAGGTATTCGCGAAG-3 '?
56 ° C

Algunas de las ventajas de utilizar PCR multiplex incluyen:
Más información con menos muestra
Mayor rendimiento
Rentable (menos dNTP, enzimas y otros consumibles)
Ahorro de tiempo (en comparación con los métodos de cultivo convencionales)
Requiere menos material de entrada
Más datos de materiales de partida limitados
Mayor precisión del análisis de datos
Menos errores de pipeteo
Realizado en un entorno cerrado para disminuir la posibilidad de contaminación

¿Qué enunciado identifica correctamente la prueba de biopsia líquida?
La biopsia líquida generalmente analiza las células cancerosas circulantes o los rastros de ARN o ADN de un cáncer presente en una muestra de sangre.

Normalmente, las variaciones de secuencia que ocurren con una frecuencia de población del 0,1% o menos se examinan para su identificación individual. En un laboratorio de pruebas de identidad, se descubrió que se producía una variante de secuencia genética con una frecuencia de aproximadamente el 2% en la población. este tipo de variante de secuencia se denomina?
polimorfismo

la enzima acetilante que metaboliza la cafeína es?
N-acetiltransferasa (NAT) 2

Para los pacientes con cáncer, la biopsia de tejido es un procedimiento estándar que se utiliza para identificar las mutaciones del cáncer y el grado de malignidad.
cierto

En comparación con la biopsia de tejido, ¿cuáles son las ventajas de la biopsia líquida?
R. La biopsia líquida es mucho menos invasiva en comparación con la biopsia de tejido.
B. La biopsia líquida suele ser mucho menos costosa de realizar que la biopsia de tejido.
C. La biopsia líquida puede potencialmente usarse para hacer un diagnóstico temprano.
D. La biopsia líquida se puede utilizar para estimar el riesgo de recaída metastásica o progresión metastásica.
**MI. Todas las opciones anteriores (A, B, C y D) son ventajas de la biopsia líquida.

Las células tumorales circulantes (CTC) son células que se han desprendido de un tumor primario y circulan en el torrente sanguíneo.
cierto

En pacientes con enfermedad metastásica, las CTC se encuentran típicamente en frecuencias de ¿en qué orden de CTC por ml de sangre total?
1-10 CTC por ml de sangre total

¿Cuáles de las siguientes afirmaciones son verdaderas para el ADN tumoral circulante (ADNct)? (Seleccione todas las que correspondan.)
* Normalmente, las células muertas y moribundas son filtradas y eliminadas del torrente sanguíneo por los fagocitos. Sin embargo, este proceso no es tan eficaz para las células malignas y da como resultado la liberación de ctDNA en el torrente sanguíneo.
* Clínicamente, se ha demostrado que los niveles relativos de ctDNA en el torrente sanguíneo de un paciente se correlacionan con la carga tumoral, aumentando a medida que el tumor se agranda y disminuyendo con la respuesta a la terapia.

Los exosomas son vesículas derivadas de células en los fluidos corporales que desempeñan un papel clave en la coagulación y se sabe que se liberan de los tumores a la sangre.
cierto

¿Cuál de las siguientes afirmaciones es precisa con respecto al significado clínico y la importancia de los exosomas?
Los exosomas se pueden usar potencialmente para el pronóstico, la terapia y como biomarcadores para la salud y la enfermedad.

La medicina ____________ emplea el perfil genético, la composición de proteínas y el entorno de un individuo para prevenir, diagnosticar y tratar enfermedades.
Personalizado

Con respecto a los pasos involucrados al realizar un ensayo típico de biopsia líquida, ¿cuál de las siguientes afirmaciones es FALSA?
En el enfoque dirigido a la amplificación y secuenciación, el método se utiliza para interrogar a todos los genes e implica la secuenciación del genoma completo o del exoma completo para descubrir nuevas mutaciones en el ADN tumoral.

¿Qué afirmación es FALSA al describir la prueba de biopsia líquida CELLSEARCH® CTC?
CELLSEARCH® es la primera prueba de biopsia líquida validada clínicamente y aprobada por la FDA para ctDNA.

El resultado de la prueba CELLSEARCH® para una paciente con cáncer de mama metastásico (mBC) se informó como ocho (8) CTC. ¿Cómo se interpretaría este resultado?
Una respuesta desfavorable.

Los resultados de la prueba CELLSEARCH® se informan como niveles de CTC que indican un pronóstico favorable versus desfavorable para ciertos cánceres metastásicos. ¿Cuál de las siguientes selecciones se consideraría un resultado favorable para un individuo con cáncer colorrectal metastásico (CCRm)?
2 CTC

La prueba de mutación cobas® EGFR v2 ha sido aprobada por la FDA para detectar mutaciones de EGFR en pacientes con cáncer de pulmón de células no pequeñas (NSCLC), como ayuda para seleccionar la terapia con un inhibidor de tirosina quinasa (TKI) EGFR.
cierto

Complete el espacio en blanco: La prueba ExoDx ™ Lung (ALK) aísla y analiza __________ exosomal contenido en muestras de sangre y detecta transcripciones de fusión EML4-ALK en plasma de pacientes con cáncer de pulmón.
ARN

La prueba ExoDx ™ Lung (ALK) es un ensayo de biopsia líquida clínica basado en exosomas, diseñado para identificar la fusión del gen EGFR-ALK que puede predecir la respuesta a las terapias con inhibidores de ALK.
FALSO

¿Qué es el sistema exoRNeasy utilizado en la prueba ExoDx ™ Lung (ALK)?
Es un sistema que utiliza columnas de centrifugación desechables para concentrar y purificar el ARN extracelular (exoARN) de las vesículas extracelulares (exosomas) contenidas en el plasma, suero u otros fluidos biológicos.

¿Qué afirmaciones son VERDADERAS? (Seleccione todas las que correspondan.)
* El crecimiento de las pruebas de biopsia líquida se ha visto favorecido por avances tecnológicos como la secuenciación de próxima generación (NGS).
* Una de las principales limitaciones de los ensayos de biopsia líquida es la falta de apoyo a la utilidad clínica de la prueba.
* El valor de las biopsias líquidas parece estar en el seguimiento en serie de la progresión del cáncer y en la evaluación de los beneficios terapéuticos de una terapia determinada.

¿Qué afirmaciones son CORRECTAS al describir el término diagnóstico complementario?
***MI. Tanto C como D son correctos.
El diagnóstico complementario utiliza información farmacogenómica relacionada con el medicamento y coloca esa información en la etiqueta de prescripción del medicamento para ayudar con las decisiones de tratamiento óptimas del paciente. Los diagnósticos complementarios permiten al médico tomar mejores decisiones sobre los medicamentos de tratamiento en función de la composición genómica del paciente.

La prueba CELLSEARCH® es la primera prueba de sangre de biopsia líquida aprobada por la FDA clínicamente validada para células tumorales circulantes (CTC), que utiliza una tecnología inmunomagnética única para capturar, aislar y enumerar las CTC.
CIERTO

Existen muchas variaciones en la tecnología de ensayo de biopsia líquida. ¿Cuáles de estos biomarcadores moleculares se extraen típicamente del plasma utilizando uno de los kits de biopsia líquida disponibles comercialmente?
*F. Las opciones A, B y D son correctas.
A. Células tumorales circulantes (CTC)
B. ADN tumoral circulante (ctDNA)
D. Exosomas

¿Qué afirmación define correctamente la diferencia entre el ADN tumoral circulante (ctDNA) y el ADN libre de células (cfDNA)?
C. Ambos circulan en el torrente sanguíneo. El ctDNA son fragmentos de DNA que se desprenden de un tumor, mientras que cfDNA es DNA que circula libremente, pero que no es necesariamente de origen tumoral.

El uso de biopsia líquida es muy prometedor para que la medicina personalizada identifique mutaciones genéticas, lo que podría llevar a prescribir una terapia tumoral personalizada basada en las características del tumor.
CIERTO

¿Cuál de las siguientes afirmaciones NO describe una limitación de la prueba de biopsia líquida?
R. La biopsia líquida suele ser más cara de realizar que la biopsia de tejido tradicional.

Dado que la biopsia líquida puede proporcionar potencialmente una evaluación completa y en tiempo real de toda la carga tumoral de un paciente individual, muchos expertos creen que tiene el potencial de reemplazar la biopsia de tejido estándar.
CIERTO

¿Qué es la tecnología Droplet Digital ™ PCR (ddPCR ™)?
*MI. Todas las opciones anteriores son correctas (A-D).
R. La tecnología permite una cuantificación absoluta y altamente sensible de ácidos nucleicos asociados con el ADN tumoral.
B. Las muestras de ácido nucleico de la sangre se dividen en miles de gotitas utilizando un sistema de emulsión de agua y aceite.
C. Cada gota actúa como una pequeña cámara de prueba individual para la amplificación del ácido nucleico.
D. La amplificación se produce en todas las gotas simultáneamente y utiliza la detección de fluorescencia para contar las gotas.

Uno de los pasos en un ensayo de biopsia líquida típico es el análisis de ctDNA, CTC y exosomas. ¿Cuál de los siguientes es VERDADERO al describir el paso del análisis?
*MI. Todo lo anterior es correcto (A-D).
A. El análisis se realiza mediante amplificación y secuenciación.
B. La amplificación y secuenciación se realiza generalmente mediante tecnologías avanzadas de secuenciación de próxima generación (NGS) y / o reacción en cadena de la polimerasa (PCR).
C. Cuando se utiliza el método "voluntario" para la amplificación y secuenciación, el objetivo es interrogar a todos los genes.
D. El enfoque "dirigido" permite un análisis dirigido más personalizado al combinar biopsias líquidas con biopsias de tejido primario estándar.

Las células tumorales circulantes (CTC) se observaron por primera vez en un paciente metastásico en 1869. En menos de diez años, los investigadores pudieron detectar y cuantificar ADN libre de células (cfDNA) tanto en pacientes sanos como enfermos.
FALSO

¿Cuáles de las siguientes son declaraciones VERDADERAS?
* La trisomía es una aneuploidía en la que hay tres copias de un cromosoma en particular en lugar de las dos copias normales.
* El síndrome de Down, también conocido como trisomía 21, ocurre cuando una persona tiene una copia adicional del cromosoma 21.

El síndrome de Turner es una afección cromosómica sexual que afecta el desarrollo en los hombres y es el resultado de la presencia de un cromosoma X adicional.
FALSO

¿Qué afirmaciones son VERDADERAS con respecto al síndrome de Down?
* El individuo afectado tendrá una triplicación del cromosoma 21, llamada trisomía 21.
* La condición está asociada con defectos cardíacos congénitos.
* Los síntomas y condiciones de salud pueden variar entre las personas con síndrome de Down y algunos tienen pocos (si los hay) problemas de salud.
* La esperanza de vida de las personas con síndrome de Down es ahora de aproximadamente 60 años.

Un diagnóstico definitivo de síndrome de Down implica la identificación de la presencia de un cromosoma número 21 adicional.
CIERTO

El estriol no conjugado (uE3-estriol) y la inhibina A dimérica (DIA) son dos de las pruebas que forman parte del panel de detección prenatal cuádruple (detección cuádruple), que se realiza en el suero materno durante el segundo trimestre del embarazo. ¿Cuáles de las siguientes pruebas también se incluyen en la pantalla cuádruple?
* Alfa-fetoproteína sérica materna (MS-AFP)
* Beta-HCG

¿Qué afirmaciones son verdaderas cuando se habla de mosaicismo placentario confinado (CPM)?
* CPM es una condición causada por una discrepancia entre la composición cromosómica / genética del feto y la placenta.
* La CPM normalmente se puede diagnosticar mediante el procedimiento CVS.
* CPM puede hacer que el procedimiento CVS produzca resultados citogenéticamente ambiguos.

¿Cuáles de las siguientes afirmaciones son VERDADERAS con respecto a las pruebas de ADN fetal libre de células (ADNcff)?
* El cffDNA se puede detectar en el plasma materno mediante la técnica de secuenciación masivamente paralela (MPS) o el análisis de ADN dirigido.
* La técnica MPS analiza millones de fragmentos de ADN libre de células (cfDNA).
Realimentación

¿Cuál de las siguientes afirmaciones describe con precisión las pruebas prenatales de ADNcf comercial disponibles actualmente para la aneuploidía fetal?
* Las pruebas prenatales MaterniT21® PLUS y Verifi® utilizan tecnología de secuenciación masivamente paralela (MPS).
* La prueba prenatal Harmony® utiliza un análisis de ADN dirigido y la técnica DANSR para el análisis digital de regiones seleccionadas.

El PRIMER paso en la técnica de secuenciación de firmas masivamente paralela (MPSS) implica la clonación in vitro de _________
fragmentos de ADNc

¿Qué prueba se considera de alta precisión para diagnosticar el síndrome de Down y / o descartar la afección, aunque es un procedimiento invasivo?
Prueba de amniocentesis para detectar anomalías cromosómicas fetales

El síndrome de Down es causado por una triplicación del cromosoma 21.
CIERTO

El síndrome de Edwards también se conoce como trisomía 13.
FALSO

Una prueba cuádruple (prueba cuádruple) realizada en suero materno durante las semanas de gestación 16-18 sugeriría un mayor riesgo de síndrome de Down si tiene esta combinación de resultados de la prueba (elija & quot; aumentado & quot o & quot; disminuido & quot de la lista desplegable para cada prueba a continuación):
* Aumento de HCG en suero materno ((MS-HCG)
* Disminución de estriol no conjugado (UE3-estriol)
* Aumento de inhibina A dimérica (DIA)
* Disminución de alfa-fetoproteína sérica materna (MS-AFP)

¿Qué afirmación es FALSA con respecto a la prueba prenatal de ADN fetal libre de células (ADNcff)?
Un resultado negativo de la prueba asegura la ausencia de aneuploidía fetal.

Las pruebas NIPT que utilizan cfDNA no se consideran diagnósticas en este momento y a las mujeres que tienen un resultado NIPT positivo se les debe ofrecer pruebas invasivas como CVS o amniocenteisis para su confirmación.
CIERTO

¿Cuál de los siguientes términos se puede definir como & cuota de números de cromosomas anormales (aumentados o disminuidos)? & Quot
Aneuploidía

La técnica de secuenciación de firmas masivamente paralela (MPSS) para aislar el ADN fetal del ADN materno requiere el análisis de una gran cantidad de fragmentos de ADN por muestra.
CIERTO

Las pruebas de detección en suero materno para el riesgo de síndrome de Down realizadas durante el PRIMER trimestre del embarazo generalmente involucran la medición de ¿cuáles dos biomarcadores?
* Gonadotropina coriónica humana beta libre (beta HCG libre)
* Proteína plasmática A asociada al embarazo (PAPP-A)

¿Cuáles de las siguientes afirmaciones son verdaderas en relación con las recomendaciones y / o pautas del ACOG para las pruebas de ADN libre de células?
* Se debe recomendar una prueba de diagnóstico para un paciente que tenga un resultado positivo en la prueba de cfDNA.
* La detección de cfDNA no se recomienda para mujeres con gestaciones múltiples.
* Si se identifica una anomalía estructural fetal en la ecografía, se deben ofrecer pruebas de diagnóstico en lugar de la detección de cfDNA.

¿Cuál de estos biomarcadores que se miden durante el primer o segundo trimestre del embarazo es secretado por el ovario e inhibe la producción de la hormona estimulante del folículo (FSH) por la glándula pituitaria?
Inhibina A

¿Qué información debe incluirse en una solicitud para un panel de detección prenatal triple o cuádruple de suero materno que se utiliza para determinar el riesgo de síndrome de Down u otras trisomías?
Edad gestacional en el momento de la recolección de la muestra
Fecha de nacimiento de la madre
Raza del paciente Peso materno
Uso de medicamentos (p. Ej., Insulina) para controlar la diabetes, si corresponde
Evidencia clínica de gestaciones múltiples (p. Ej., Gemelos), si corresponde
*Todo lo anterior

¿Cuáles de las siguientes afirmaciones son VERDADERAS cuando se habla de pruebas NIPT de ADN libre de células (cfDNA)?
La precisión de cualquier ensayo de cfDNA NIPT depende de la fracción fetal del cfDNA total existente en la sangre materna.
La mayoría de los ensayos NIPT recomiendan realizar pruebas en mujeres embarazadas de diez semanas o más de gestación para garantizar niveles adecuados de cffDNA (fracción fetal).
El tamaño de la madre, especialmente un peso corporal de la madre alto, puede causar un efecto de dilución que da como resultado una fracción fetal más baja.
La presencia de mosaicismo placentario confinado (CPM) o un gemelo desaparecido puede causar un resultado falso positivo al realizar la prueba NIPT
**Todo lo anterior

¿Cuál de las siguientes afirmaciones describe correctamente la enfermedad de Alzheimer (EA)?
* La EA es la forma más común de demencia en los ancianos.
* La EA es un trastorno cerebral irreversible y progresivo.
* Una de cada 10 personas de 65 años o más tiene EA en los EE. UU.

¿Qué "etapa" de la enfermedad de Alzheimer (EA) suele ser la más larga (a menudo dura muchos años) y el individuo tiene dificultades para realizar tareas pero aún recuerda detalles de la vida?
Moderar

Se cree que la enfermedad de Alzheimer (EA) es causada por una combinación de factores genéticos, de estilo de vida y ambientales.
CIERTO

¿Qué afirmaciones son correctas con respecto al diagnóstico de EA?
* Actualmente no existe una única prueba de diagnóstico definitiva para diagnosticar la EA.
* Se puede hacer un diagnóstico definitivo después de la muerte del individuo mediante un examen microscópico del tejido cerebral.
* El diagnóstico de EA se suele realizar mediante exclusión o mediante el uso de otras pruebas para descartar la afección.
* El historial médico y el examen del estado mental de un paciente se emplean como parte del enfoque de diagnóstico.

¿Qué tipo específico de exploración por TEP mide los ovillos neurofibrilares en el cerebro?
PET Tau

Las pruebas genéticas de ciertos genes involucrados en el desarrollo de la EA están disponibles y ahora se recomienda el uso de dichas pruebas genéticas para la evaluación de rutina de la EA.
FALSO

En un pequeño porcentaje de los casos de EA, las mutaciones genéticas que ocurren en ciertos genes pueden causar AD directamente. ¿Cuál es el nombre que se les da a estos genes?
Genes deterministas

¿Qué afirmaciones son verdaderas en relación con los biomarcadores de la EA?
* Se han estudiado biomarcadores tanto en LCR como en sangre.
* Se han utilizado biomarcadores para ayudar en los estudios de investigación sobre la detección temprana, la prevención y los efectos de posibles tratamientos.

¿Qué péptido, cuando se deposita en placas, se puede encontrar en niveles bajos en el LCR y puede ser un biomarcador clave de la EA?
Péptido AB42

Se ha desarrollado y estudiado un análisis de sangre para detectar la proteína IRS-1. Los estudios han demostrado que las personas con EA pueden tener niveles sanguíneos más bajos de la forma inactiva de la proteína IRS-1.
FALSO

¿Cuáles son las limitaciones del uso de LCR para medir biomarcadores de EA?
* El LCR requiere la realización de una punción lumbar invasiva para obtener una muestra.
* Existe un alto costo asociado con la recolección de LCR.

¿Cuáles de las siguientes afirmaciones son verdaderas al describir la relación AB42 / 40 de Quest Diagnostic y la prueba del panel de isoformas APOE?
* La prueba utiliza LC / MS / MS para medir e identificar los biomarcadores.
* La prueba mide los péptidos AB42 y AB40 y expresa los resultados como una relación AB42 / AB40.
* La prueba mide el APOE total y las diversas isoformas de APOE

Una limitación para usar la prueba de riesgo de Alzheimer APOE de LabCorp es que la presencia de la isoforma APOE e4 sí aumenta el riesgo de EA de aparición tardía; sin embargo, muchos pacientes con la isoforma e4 no desarrollan EA y en aquellos con EA de inicio tardío, 30- El 50% son negativos para la isoforma.
CIERTO

¿Qué biomarcadores de EA mide la prueba de evaluación de Alzheimer ADmark de Athena Diagnostic?
Isoformas AB42APOE
Tau total
Fosfo-Tau

¿Qué conclusiones se pueden extraer de las pruebas de biomarcadores para la evaluación de la EA?
* Actualmente, no se utiliza ningún biomarcador o panel de biomarcadores específicos para realizar un diagnóstico definitivo de la EA.
* Para estudios de investigación, los biomarcadores de EA se utilizan para la detección temprana, la prevención y los efectos de posibles tratamientos.
* En la práctica clínica, los biomarcadores de LCR para la EA se utilizan principalmente para ayudar en el diagnóstico para mejorar la precisión.

¿Qué afirmación describe correctamente las recomendaciones de la sociedad profesional y las aseguradoras para el uso de biomarcadores de EA?
No cumplen con las recomendaciones o los respaldos reales para el uso de biomarcadores de EA.

¿Qué afirmaciones son verdaderas en relación con el tratamiento de la EA?
* Actualmente, el tratamiento se centra en el mantenimiento de las funciones mentales y el manejo y control de los síntomas conductuales de la EA.
* Los medicamentos no detendrán la enfermedad, pero pueden retrasar varios síntomas durante un período de tiempo.
* Es poco probable que algún fármaco tenga éxito en el tratamiento de la EA.

Uno de los tipos de medicamentos actuales para la EA son los inhibidores de colinesterasa. Estos medicamentos retrasan la progresión de los síntomas asociados con la EA de moderada a grave. Actúan bloqueando los efectos tóxicos del exceso de glutamato en el cerebro.
FALSO

¿Qué afirmación que describe la enfermedad de Alzheimer (EA) NO es cierta?
La EA es la segunda forma más común de demencia en los ancianos.

La investigación ha demostrado que dos proteínas clave (placas y ovillos) pueden desempeñar un papel en la causa de la EA. ¿Qué proteína es un fragmento sobrante que puede formar placas en el cerebro?
Beta-amiloide

Actualmente, no existe una única prueba de diagnóstico definitiva que se pueda utilizar para diagnosticar la EA. En cambio, el diagnóstico generalmente se realiza mediante exclusión o utilizando otras pruebas para descartar otras afecciones que pueden causar síntomas similares.
CIERTO

¿Qué tipo de tomografía por emisión de positrones (PET) se usa para mostrar áreas del cerebro en las que los nutrientes se metabolizan mal?
PET con fluorodesoxiglucosa (FDG)

¿Cuál de las siguientes pruebas genéticas identifica un gen de "riesgo" y su isoforma que se cree que aumenta el riesgo de EA pero que no causa directamente la EA?
Isoforma APOE e4

¿Usar qué proporción de dos beta amiloide (péptidos AB) medidos en el LCR puede proporcionar una mejor evaluación de la formación de placa amiloide?
Relación AB42 / AB40

Se evaluó a un paciente con sospecha de enfermedad de Alzheimer y síntomas relacionados mediante el panel de isoformas beta amiloide y APOE de Quest Diagnostics. El panel Quest se realizó en LCR recolectado del paciente y los resultados fueron los siguientes:
La presencia de la isoforma APOE e4
Una relación AB42 / AB40 de 0,15
Un puntaje de evaluación de riesgo de algoritmo de 1.5
** Un alto riesgo de EA

¿Qué metodología o combinación de metodologías se utilizan en la prueba de riesgo de Alzheimer APOE de LabCorp?
PCR con digestión con enzimas de restricción y electroforesis en gel de poliacrilamida.

Con la prueba de evaluación de Alzheimer ADmark de Athena Diagnostic, la presencia principalmente de la isoforma APOE e2 en lugar de la isoforma APOE e4 sugiere una menor probabilidad de EA.
CIERTO

¿Qué conclusiones se pueden sacar en relación con las pruebas de biomarcadores para la evaluación de la EA o la demencia relacionada?
* No se utiliza ningún biomarcador específico o panel de biomarcadores para hacer un diagnóstico definitivo de EA.
La principal fuente de muestras para diversos biomarcadores sigue siendo Los biomarcadores CSFCSF se utilizan en la práctica clínica principalmente como ayuda para mejorar la precisión del diagnóstico de la EA.

La Alzheimer's Association recomienda actualmente el uso de la relación AB42 / AB40 en LCR para su uso en la práctica clínica.
FALSO

¿Qué afirmaciones son correctas sobre el tratamiento actual de la EA?
* Es poco probable que algún fármaco o terapia tenga éxito en el tratamiento de la enfermedad.
* Los medicamentos que se usan para tratar la EA no detendrán la enfermedad, pero pueden retrasar varios síntomas.
* El tratamiento actual se centra en el mantenimiento de las funciones mentales y el control de los síntomas.


DISCUSIÓN

En este artículo hemos ampliado y mejorado la metodología para derivar las energías NNBP en el ADN a partir de experimentos de una sola molécula. La introducción de la simetría circular en el modelo NN nos permite reducir el número de energías NNBP de diez a ocho. La simetría circular ya se notó en (28) donde un análisis de estabilidad del mínimo alcanzado por optimización estocástica en el espacio de energía de diez NNBP destacó una variedad bidimensional de soluciones óptimas. Tal degeneración doble concordaba con las dos relaciones de energía NNBP autoconsistentes empleadas aquí (SI Apéndice D). Al evitar tal degeneración, la optimización estocástica se vuelve más rápida y confiable en el espacio de ocho parámetros. Además, hemos demostrado que los efectos finales en la fusión dúplex se pueden medir directamente abriendo mecánicamente horquillas de ADN largas. La diferencia entre las contribuciones del factor de iniciación (FI) AT y CG es más importante alrededor de los máximos y mínimos a lo largo de la FDC. La incorporación de simetría circular e IF en el análisis ha llevado a valores de corrección de sal mejor ajustados y una predicción más precisa de las temperaturas de fusión de las secuencias de oligo.

Nuestros resultados informan valores de corrección de sal específicos de pares de bases de Mg 2+ que son fuertemente heterogéneos o dependientes de la secuencia. Este hecho ya se observó en (28) en Na + pero en menor grado y ahora se ha confirmado adicionalmente en el caso de Mg 2+. En (46), se ha demostrado que el apilamiento (en lugar del emparejamiento de bases) determina completamente la dependencia de la sal de los parámetros de estabilidad del ADN en condiciones monovalentes. Esto está de acuerdo con (28), donde se encontró que las correcciones de sales monovalentes dependían del tipo de pila (purina / purina o purina / pirimidina). Por el contrario, en el magnesio se observa una clara correlación entre las correcciones dependientes de la sal y el contenido de NNBP GC, lo que muestra que el emparejamiento de bases en lugar del apilamiento de bases determina la dependencia de la sal. Esta correlación de secuencia se ha cuantificado y concuerda con los datos de predicción de la temperatura de fusión según se informa en la Ref. (28) (SI Apéndice F). Este acuerdo valida la naturaleza heterogénea recientemente descubierta de las correcciones de sal NNBP.

Combinando los resultados de este trabajo con los de (28), ahora tenemos todos los parámetros para un modelo NN global y consistente en una amplia gama de condiciones de temperatura y sal donde las fluctuaciones y los efectos de correlación entre los iones ligados al magnesio son débiles. Por lo que podemos ver, los números de energía de descompresión que presentamos parecen ser totalmente compatibles (dadas algunas suposiciones sobre las dependencias de temperatura y sal de la entalpía y las entropías) con el conjunto de datos UO ampliamente utilizado. Este resultado está lejos de ser trivial, ya que el conjunto de datos de UO se obtiene de experimentos de desnaturalización térmica a altas temperaturas, mientras que los datos de descompresión se obtienen de métodos de fuerza a temperatura ambiente. De hecho, la tarea de hacer coincidir los números de energía medidos en regímenes de temperatura tan separados no es sencilla. Además, el estado final es completamente diferente en ambos casos (bobina aleatoria desplegada en el primer caso, polímero estirado en el otro). Estos resultados demuestran la compatibilidad de los conjuntos de datos termodinámicos derivados de los experimentos de desnaturalización térmica en ensayos de fuerza a granel y de descompresión, proporcionando así una validación nueva e independiente del modelo NN tan central en la termodinámica de ácidos nucleicos.

En resumen, a pesar de la naturaleza complicada de las correcciones de sal logarítmica a las energías libres de NNBP, nuestra corrección de sal de pares de bases de NNBP heterogénea proporciona un esquema de ajuste matemáticamente simple tanto para la temperatura de fusión como para descomprimir los datos en casi dos órdenes de magnitud de concentración de magnesio. El buen rendimiento de la corrección lineal-logarítmica también sugiere que por debajo de 10 mM de Mg 2+ los efectos de correlación y fluctuación entre los iones de magnesio unidos son débiles, aunque muestran una fuerte correlación con el contenido de GC. Los efectos dependientes de la secuencia observados debido a la naturaleza heterogénea de las correcciones de sal son suficientes para explicar todos los datos de descompresión y fusión en ese régimen. En este sentido, nuestro razonamiento para reproducir todos los datos experimentales disponibles en el rango & lt10 mM se basa en asumir correcciones de sal heterogéneas para los diferentes NNBP, un hecho que se ha pasado por alto en estudios anteriores pero que está directamente respaldado por nuestros datos experimentales. Por ejemplo, tanto el modelo de iones estrechamente ligados (TBI) altamente predictivo (53, 54) como la teoría de Poisson-Boltzmann son enfoques de campo medio que tratan el ADN como un polielectrolito cargado uniformemente donde es difícil incluir efectos de nucleótidos específicos. En este sentido, la demostración experimental de correcciones salinas dependientes de NNBP heterogéneas es un resultado relevante útil para desarrollar nuevos enfoques sobre electrostática de ácidos nucleicos que van más allá de las teorías de campo medio existentes en la actualidad.

Los estudios futuros deberían considerar los efectos de correlación de iones mediante la realización de experimentos de descompresión a concentraciones de magnesio superiores a 10 mM. Los números de energía determinados en ese caso podrían permitirnos encontrar nuevas dependencias de sal para las energías NNBP más allá de la corrección logarítmica lineal. Esto sería relevante para comprender mejor los efectos iónicos de fluctuación y correlación en los ácidos nucleicos y, al mismo tiempo, predecir correctamente las temperaturas de fusión sin necesidad de introducir fórmulas empíricas que asuman correcciones salinas homogéneas e incluyan correcciones logarítmicas cuadradas que son difíciles de interpretar (36 , 45).

Finalmente, nuestro estudio no aborda los efectos de la competencia entre los iones Na + y Mg 2+ y se necesitan más experimentos para determinarlos. Los resultados preliminares que hemos informado aquí nos permiten interpolar la dependencia de la sal de las energías NNBP entre los casos de Na + y Mg 2+, lo que indica que los efectos estabilizadores de 1,6 Na + son aproximadamente equivalentes a un solo Mg 2+. Otros estudios también deberían considerar la medición directa de las entalpías y entropías de NNBP realizando experimentos de descompresión a diferentes temperaturas (35), los efectos de la capacidad calorífica en la fusión del ADN (47, 48), la contribución del apilamiento de bases y los enlaces de hidrógeno a las energías de NNBP. (46, 54) y, finalmente, la evaluación de las correcciones del Próximo Vecino más cercano a partir de las curvas de descompresión, como siguiente paso para mejorar el modelo NN.


Figura 2

Figura 2. Cambio de longitud de onda mediante transferencia de energía (ET). (a) Esquema de las vías de transferencia de energía desde los aceptores YOYO-1 intercalados a los terminales Cy5. Las vías intradúplex (azul) e inter (gris) son posibles en un sistema DBBP, mientras que solo la ET intradúplex es posible en el ADN sin cepillo. (b) El ADN inmovilizado con cepillo muestra una ET más alta (espectros de la izquierda) en comparación con el ADN sin cepillo en solución (espectros de la derecha). Las trazas rojas y azules corresponden a DBBP que incluyen o excluyen, respectivamente, colorantes Cy5 terminales covalentes en todas las hebras de ADN hibridadas. La ET se calcula en función de la disminución de la fluorescencia de YOYO-1 a 510 nm (flecha cian); consulte Métodos. (c) Comparación de ADN en cepillo (curvas negras) y sin cepillo (curvas rojas) a diferentes longitudes de onda de excitación. Espectros izquierdos: excitación a 633 nm (excitación directa de C5). Intensidades similares indican una falta de auto-extinción de Cy5 en el cepillo. Espectros de la derecha: excitación a 450 nm (excitación de YOYO-1). La mayor emisión de Cy5 en el cepillo se debe a una mayor eficiencia de ET.


Abstracto

Resumen

El ADN en su forma más simple es un conjunto de ácidos nucleicos, agua e iones, y la conformación del ADN depende de las proporciones relativas de los tres componentes. Cuando el ADN se daña covalentemente por especies reactivas endógenas o exógenas, incluidas las producidas por algunos fármacos contra el cáncer, el conjunto sufre cambios localizados que afectan la estructura del ácido nucleico, la estabilidad termodinámica y la disposición cualitativa y cuantitativa de los cationes y moléculas de agua asociados. Afortunadamente, los efectos biológicos de los niveles bajos de daño en el ADN se mitigan con éxito mediante una gran cantidad de proteínas que reconocen y reparan de manera eficiente el daño del ADN en medio de un gran exceso de ADN canónico.

En este informe, exploramos el impacto de las modificaciones del ADN en la estructura dinámica y de alta resolución del ADN, la estabilidad del ADN y la absorción de iones y agua, y exploramos cómo estos cambios pueden ser detectados por proteínas cuya función es localizar inicialmente las lesiones del ADN. Discutimos modificaciones en las nucleobases que se encuentran en los surcos mayor y menor del ADN e incluyen lesiones que se observan en vivo, incluidas las bases oxidadas, así como algunas nucleobases sintéticas que nos permiten investigar cómo la ubicación y la naturaleza de los diferentes sustituyentes afectan la termodinámica y la estructura del conjunto de ADN. Se demuestra que la rotura de un sitio de unión de cationes en el surco principal por modificación de la posición N7 en las purinas, que es el sitio principal para la alquilación del ADN, es entalpicamente desestabilizador. Por consiguiente, atar una carga catiónica en el surco principal se estabiliza entálpicamente.

Los estudios estructurales y termodinámicos combinados proporcionan una imagen detallada de cómo las diferentes lesiones del ADN afectan la dinámica del ADN y cómo las bases modificadas interactúan con su entorno. Nuestro trabajo apoya la hipótesis de que existe una “firma termodinámica” en las lesiones de ADN que se puede explotar en la búsqueda inicial que requiere la diferenciación entre ADN canónico y ADN con una lesión. La diferenciación entre una lesión y una lesión análoga que es un sustrato de una enzima particular implica otra capa de factores termodinámicos y cinéticos.


Illumina, Inc y amp Anor contra TDL Genetics Ltd y amp Ors

1. El Segundo Demandante es titular de la Patente Europea (Reino Unido) No. 1 524 321 titulada Detección no invasiva de rasgos genéticos fetales (la Patente), que tiene una fecha de presentación de 16 de octubre de 2003. El Primer Demandante ha sido un licenciatario de la Patente desde al menos el 11 de enero de 2019. El Tercer Demandado (Ariosa), que es miembro del grupo de empresas Roche, ha desarrollado una prueba prenatal no invasiva (NIPT) llamada Harmony Test. El primer acusado (TDL) ofrece la prueba de armonía a los pacientes y la utiliza. Las Demandantes alegan que TDL ha infringido la Patente. Ariosa admite que es solidariamente responsable de cualquier infracción por parte de TDL. Los Demandados disputan que la prueba Harmony infringe la Patente y contrademandan la revocación de la Patente por razones de obviedad sobre Ikeda et al, Frecuencia a la que el ADN fetal está presente en el plasma materno: Diferencia por longitud de fragmento, J Japan Soc de Obs & Gyn , 55 (2), P-910 (2003) (Ikeda) e insuficiencia. Varias otras cuestiones planteadas por los Demandados no se abordaron en las alegaciones finales.

2. Ambas partes llamaron a dos expertos técnicos, pero los dos pares de expertos no eran pares coincidentes. Además, cada parte llamó a un experto en japonés para abordar un tema relacionado con la traducción de Ikeda.

Los expertos técnicos de las Demandantes

3. Desde 2015, el profesor William Allen Hogge ha sido profesor en el Departamento de Obstetricia y Ginecología de la Virginia Commonwealth University. Obtuvo una licenciatura en Biología de la Universidad de Virginia en 1970 y un MD de la misma institución en 1973. Después de una residencia en Obstetricia y Ginecología en el Hospital de la Universidad de Virginia y un período en la práctica privada, ocupó una serie de Asistente y Asociado Cargos de profesor en departamentos de obstetricia y ginecología de 1982 a 1992. De 1992 a 2014 fue profesor en el Departamento de Obstetricia y Ginecología de la Facultad de Medicina de la Universidad de Pittsburgh (UP). Desde 1992 también fue Profesor Asociado de Genética Humana y Director de Genética Reproductiva en la UP y Director Médico del Departamento de Genética del Magee-Women's Hospital en Pittsburgh (MWH). De 1997 a 2013 fue Director del Laboratorio de Detección de Embarazo en MWH. De 2003 a 2014 fue Director del Centro de Genética y Genómica Médica de la UP y Catedrático del Departamento de Obstetricia y Ciencias Reproductivas de la Facultad de Medicina de la UP. De 2010 a 2014 también fue profesor en el Departamento de Patología de la Facultad de Medicina de la UP. Su trabajo clínico ha consistido en la realización de procedimientos de diagnóstico prenatal, como amniocentesis y CVS, y ha estado involucrado en investigaciones relacionadas con métodos de diagnóstico prenatal no invasivo. Es autor o coautor de 19 libros y más de 80 publicaciones científicas relacionadas con el diagnóstico prenatal.

4. El abogado de los acusados ​​aceptó que el profesor Hogge había prestado pruebas de manera mesurada y no lo criticó. El abogado sostuvo que la experiencia personal relevante del Prof. Hogge era más limitada que la de los expertos de los Demandados, pero aceptó que el Prof. Hogge conocía el estado y pensaba en el campo del ADN libre de células en la fecha de presentación.

5. Desde 2013, el profesor Michael Lovett es profesor de biología de sistemas en el Instituto Nacional del Corazón y los Pulmones del Imperial College de Londres. Obtuvo una licenciatura en Biología Molecular de la Universidad de Edimburgo en 1977 y un doctorado en Bioquímica de Imperial en 1981. De 1982 a 1987 fue primero becario postdoctoral y luego profesor asistente de genética en la Universidad de California, San Francisco. De 1987 a 1992 trabajó para Genelabs Inc. De 1992 a 1999 fue Profesor Asociado de Bioquímica en el Centro Médico de la Universidad de Texas Southwestern. De 1999 a 2013 fue Profesor de Genética y Jefe de División de Genética Humana en la Facultad de Medicina de la Universidad de Washington en St Louis, que era uno de los cinco centros de genoma primarios del mundo. En 2003 estaba realizando un trabajo sobre métodos de selección directa de regiones definidas de material genómico, lo que permitió la captura y secuenciación específicas de genes de interés y el descubrimiento de mutaciones en los trastornos mendelianos. El profesor Lovett es autor o coautor de más de 100 publicaciones científicas relacionadas con la genética molecular y genómica de mamíferos.

6. El abogado de los acusados ​​no criticó al profesor Lovett como testigo, pero afirmó que era importante apreciar que los antecedentes del profesor Lovett estaban relacionados con la expresión genética y que (a diferencia del Dr. Daniels) el profesor Lovett no estaba en la fecha de presentación y nunca había estado, en el campo del ADN libre de células. Acepto que este es un factor relevante que debo tener en cuenta, pero por otro lado no se sugirió que el profesor Lovett no estuviera en condiciones de ayudar al Tribunal en cuanto a cómo entendería Ikeda el experto en la materia.

Los expertos técnicos Demandados

7. Antes de su jubilación en octubre de 2015, el Dr. Geoff Daniels fue Jefe de Diagnóstico en el Laboratorio de Referencia de Grupos Sanguíneos Internacionales (IBGRL) en Bristol e Investigador Senior en el Instituto de Ciencias de Transfusión de Bristol (BITS). Obtuvo una licenciatura en Zoología de la Universidad de Aberdeen en 1972 y un doctorado de la Universidad de Londres en 1980. De 1972 a 1973 trabajó en el Centro de Transfusión del Sur de Londres. De 1973 a 1995 trabajó en la Unidad de Grupos Sanguíneos del Medical Research Council. De 1995 a 2015 trabajó en IBGRL, convirtiéndose en Jefe de Diagnóstico Molecular en 2001 y Jefe de Diagnóstico en 2012, y en BITS. De 1988 a 2015 también tuvo responsabilidades docentes en la Universidad de Bristol. Desde 2001, aproximadamente la mitad de su tiempo la dedicó a la gestión de un servicio de fenotipado de grupos sanguíneos (aproximadamente la mitad de los cuales involucró pruebas prenatales no invasivas de antígenos de grupos sanguíneos utilizando plasma materno) y la otra mitad dirigió un pequeño equipo de investigación y la docencia. En 2001, colaboró ​​en el establecimiento de un servicio para pruebas prenatales no invasivas para RhD en ADN libre de células fetales en plasma materno utilizando PCR cuantitativa basada en Lo 1998 (sobre lo cual, ver más abajo). En 2003, la mayoría de las muestras recibidas por IBGRL para pruebas prenatales eran para RhD, pero algunas eran para pruebas de marcadores del cromosoma Y. El Dr. Daniels es autor de un libro y coautor de otro libro sobre grupos sanguíneos y ha publicado más de 200 artículos científicos durante su carrera.

8. El abogado de las Demandantes aceptó que el Dr. Daniels había presentado su testimonio oral de manera muy justa. El abogado sostuvo que la evidencia del Dr. Daniels sobre Ikeda estaba contaminada por la retrospectiva y por el conocimiento personal que tenía en la fecha de presentación, puntos que es conveniente considerar en contexto, pero dejó en claro que esto no era una crítica del Dr. Daniels personalmente.

9. Desde 2008, el profesor Alain Thierry es Director de Investigación del INSERM en el Institut de Recherche en Canc rologie de Montpellier. Obtuvo una licenciatura en Ciencias Biológicas y Tecnología de la Universit de Clermont en 1981, una maestría de la Universit de Clermont-Ferrand II en 1983 y un doctorado de la Universit Montpellier 2 en 1986. De 1986 a 1992 ocupó puestos de posdoctorado en la Universit de Clermont-Ferrand II y el Lombardi Cancer Center, Georgetown University Medical Center, y de 1992 a 1996 fue profesor adjunto adjunto en esta última institución. De 1997 a 2001 fue Director Científico del Departamento de Terapia Genética y Entrega de Biovector Therapeutics. De 2001 a 2007 fue profesor asociado en la Universit Montpellier 2, donde trabajó en la entrega de genes y la terapia génica y la biofísica de los complejos de ADN. Desde 2005, su investigación se ha centrado en el tamaño, la estructura y el origen del ADN libre de células circulantes, y en la aplicación de métodos para detectar ADN libre de células circulantes, especialmente en el campo de la oncología. Es autor de más de 20 publicaciones revisadas por pares relacionadas con el ADN libre de células circulantes.

10. Los Demandados se basaron principalmente en las pruebas del profesor Thierry en apoyo de su caso de insuficiencia. Los abogados de las Demandantes sostuvieron que el Prof. Thierry era un hombre con una misión. El abogado aceptó que el celo del profesor Thierry era completamente genuino, pero sostuvo que la pregunta para el Tribunal era si sus opiniones estaban respaldadas por los datos disponibles. Estoy de acuerdo con ésto.

11. El experto de las Demandantes fue el Profesor Peter Kornicki. El profesor Kornicki es un hablante nativo de inglés que ha sido profesor emérito de estudios japoneses en la Universidad de Cambridge desde 2014. Obtuvo una licenciatura en japonés y coreano de la Universidad de Oxford en 1972, seguido de una maestría en 1975 y un doctorado en japonés. Literatura en 1979. De 1978 a 1982 enseñó en la Universidad de Tasmania y de 1982 a 1985 en la Universidad de Kyoto. Entre 1985 y 2014 fue sucesivamente conferencista, lector de Historia y Bibliografía Japonesa, Catedrático de Estudios Japoneses y Catedrático de Estudios de Asia Oriental en Cambridge.Entre otros honores, ha sido elegido Fellow de la Academia Británica, otorgado el grado de Doctor en Letras por la Universidad de Oxford y la Orden del Sol Naciente con Rayos Dorados y Cinta en el Cuello por el Emperador de Japón. Ha publicado varios libros y muchos artículos sobre la cultura japonesa y, en particular, libros japoneses.

12. El experto de los Demandados fue el profesor Yoshifumi Itoh. El profesor Itoh es un hablante nativo de japonés que ha sido profesor titular en el Instituto Kennedy de Reumatología desde 2001, inicialmente en el Imperial College de Londres y desde 2011 en la Universidad de Oxford. El profesor Itoh se educó en Japón y estudió inglés como segundo idioma. Obtuvo una Licenciatura en Farmacia de la Facultad de Farmacia de Tokio en 1989, una Maestría en Farmacia Clínica (Bioquímica) de la misma institución en 1991 y un Doctorado de la misma institución en 1996. De 1991 a 1997 trabajó primero como Asistente de Investigación y luego como becario postdoctoral en el Centro Médico de la Universidad de Kansas. De 1997 a 2001 fue profesor adjunto en el Departamento de Investigación del Cáncer del Instituto de Ciencias Médicas de la Universidad de Tokio. Durante el transcurso de su carrera, el profesor Itoh ha trabajado extensamente tanto en japonés como en inglés, y ha escrito y revisado numerosos artículos científicos en ambos idiomas.

13. Es un hecho común que tanto el profesor Kornicki como el profesor Itoh hicieron todo lo posible para ayudar a la Corte. Los abogados de las Demandantes sostuvieron que el profesor Kornicki estaba en mejores condiciones para hacerlo porque la experiencia del profesor Kornicki es (entre otras cosas) como lingüista japonés, mientras que el profesor Itoh no es lingüista. Además, el profesor Kornicki es un hablante nativo de inglés y, en general, se acepta que los traductores deben traducir a su lengua materna. El abogado de los acusados ​​sostuvo que el profesor Itoh estaba en una mejor posición para ayudar al Tribunal, ya que es un hablante nativo de japonés familiarizado con la forma en que se escriben los resúmenes científicos tanto en japonés como en inglés. En mi opinión, fue útil contar con pruebas desde ambas perspectivas.

14. La siguiente descripción de los antecedentes técnicos se basa principalmente en la cartilla convenientemente acordada por las partes.

15. El genoma humano representa el conjunto completo de instrucciones heredadas codificadas en ácido desoxirribonucleico (ADN) en una célula humana. El genoma haploide humano (es decir, un conjunto de cromosomas) consta de aproximadamente 3 mil millones de pares de bases de ADN. En individuos diploides típicos (es decir, individuos con un emparejamiento equilibrado de cromosomas), el genoma está organizado en un total de 46 cromosomas.

16. Los cromosomas constan de ADN y complejos de proteínas. El ADN cromosómico consta de dos hebras complementarias que se enrollan para formar una doble hélice. La doble hélice de ADN se enrolla firmemente alrededor de las proteínas histonas para formar complejos llamados nucleosomas. Los nucleosomas se pliegan para formar fibras de cromatina que se enrollan para formar la cromátida de un cromosoma. La organización estructural de un cromosoma se muestra en la Figura 1 a continuación. Durante procesos como la transcripción y la replicación, las fibras de cromatina se abren y / o las histonas se eliminan transitoriamente para permitir que prosiga la transcripción o replicación.

17. Las hebras de ADN están formadas por nucleótidos, que están compuestos por un esqueleto de azúcar fosforilado (desoxirribosa), cada unidad de azúcar está unida a una base nitrogenada. Hay cuatro bases nitrogenadas diferentes en el ADN: adenina (A), citosina (C), guanina (G) o timina (T). Las dos hebras complementarias se mantienen unidas (entre otras interacciones) mediante el apareamiento de bases con la formación de enlaces de hidrógeno entre las bases, donde la regla general es que la citosina (C) solo se empareja con la guanina (G) y la adenina (A) solo se empareja con timina (T). La citosina (C) se empareja con la guanina (G) mediante tres enlaces de hidrógeno, mientras que la adenina (A) se empareja con la timina (T) mediante dos enlaces de hidrógeno.

18. El ADN cromosómico se replica en el núcleo de la célula humana. Como se explicó anteriormente, para que esto ocurra, los complejos de ADN-proteína deben desmontarse y las cadenas de ADN deben separarse temporalmente en la región del ADN que se replica. Las helicasas de ADN catalizan la separación enzimática dependiente de las hebras complementarias del sitio de las proteínas iniciadoras previamente unidas, lo que permite que la actividad de la enzima polimerasa de ADN sintetice dos nuevas hebras utilizando desoxinucleósidos trifosfatos libres (dNTP). Con la incorporación de cada desoxinucleótido en la cadena de ADN en crecimiento, se libera un pirofosfato (dos grupos fosfato unidos entre sí). Cada hebra de la molécula de ADN original actúa como plantilla para la producción de una hebra complementaria con el fin de formar dos copias de la molécula de ADN original. En la Figura 3 a continuación se muestra una representación esquemática de la replicación del ADN.

19. Los genes son unidades funcionales de ADN en el genoma que codifican proteínas particulares y ARN no codificantes. Los genes que codifican proteínas pueden transcribirse para producir ácido ribonucleico mensajero (ARNm), que a su vez puede traducirse para producir la proteína codificada por el gen.

20. Los 46 cromosomas de una célula somática humana normal (células distintas de los gametos (espermatozoides y óvulos), células germinales (células que dan lugar a gametos), gametocitos y células madre indiferenciadas) se componen de 22 pares de autosomas homólogos (cromosomas no sexuales) y dos alosomas (cromosomas sexuales XX para mujeres típicas y XY para hombres típicos). Un conjunto de 23 cromosomas se hereda de forma materna y un conjunto de 23 cromosomas se hereda de forma paterna. Se dice que los autosomas (y los cromosomas X en el caso de las mujeres XX típicas) son diploides (o emparejados).

21. Cada cromosoma lleva un conjunto de genes. En las células somáticas normales, los genes autosómicos están presentes en pares, un gen se hereda por vía materna y el otro se hereda por vía paterna. Cada gen está codificado en un sitio o locus específico de un cromosoma. Las diferentes versiones de un gen (por ejemplo, causadas por variantes como cambios de base única o múltiple) pueden denominarse alelos. Cuando un individuo tiene dos copias del mismo alelo (es decir, el mismo alelo en un locus particular en cada cromosoma dentro de un par), se dice que es homocigótico con respecto al alelo donde los alelos son diferentes (es decir, hay alelos diferentes en un locus particular en cada cromosoma dentro de un par), se dice que el individuo es heterocigoto con respecto a ese alelo. Se dice que un individuo es hemicigótico cuando tiene solo un alelo, en lugar de los dos típicos (lo que puede surgir, por ejemplo, cuando solo está presente un cromosoma de un par, cuando se ha eliminado una copia de un alelo o, en condiciones normales, células somáticas masculinas, con respecto a ciertos genes contenidos en los alosomas).

22. Las células somáticas masculinas normales contienen un cromosoma X heredado por la madre y un cromosoma Y heredado por el padre, mientras que las células somáticas femeninas normales contienen dos cromosomas X, uno heredado por la madre y otro por herencia. Los gametos normales (espermatozoides y óvulos) son haploides, lo que significa que contienen solo una copia de cada cromosoma. Los óvulos normales llevan un alosoma X. Aproximadamente el 50% de los espermatozoides contienen un alosoma X y el 50% contiene un alosoma Y.

23. Por lo general, el genotipo del alosoma de la madre es XX, por lo que ella pasa un cromosoma X a su descendencia y el genotipo alosoma del padre es XY, por lo que él pasa un cromosoma X a su descendencia (lo que resulta en una niña con un genotipo XX), o un cromosoma Y (resultando en un niño varón con un genotipo XY). Sin embargo, hay una serie de condiciones genéticas aberrantes conocidas que involucran a los alosomas, incluidas las aneuploidías.

24. La existencia de diferentes variantes en un locus se denomina polimorfismo genético. La presencia de una variante particular en un locus polimórfico puede actuar como marcador. Si bien algunas variantes dan lugar a fenotipos biológicos distintos (es decir, rasgos o características observables de los individuos, como el color de ojos o el grupo sanguíneo), otras tienen un efecto fenotípico desconocido o nulo.

25. Pueden surgir diferentes alelos a través de cambios de base única o cambios de bases múltiples. Los cambios de una sola base que ocurren con al menos una cierta prevalencia en una población, ahora se conocen como polimorfismos de un solo nucleótido o SNP. Genotipado significa identificar diferencias entre el ADN de un individuo y la población general u otros individuos específicos.

26. Los trastornos genéticos pueden deberse a cambios patógenos en el genoma. Los trastornos genéticos incluyen trastornos mendelianos (o de un solo gen), en los que se altera un solo gen, o trastornos cromosómicos, en los que un cromosoma completo, o un segmento grande del mismo, se elimina, duplica, transloca o altera de otro modo.

27. Los trastornos genéticos pueden ser hereditarios o pueden surgir por primera vez en el óvulo, el espermatazoo o el óvulo fecundado (denominado de novo), o pueden surgir durante la vida de una persona (denominado adquirido).

28. Los trastornos mendelianos (también conocidos como trastornos de un solo gen) son trastornos genéticos causados ​​por una mutación en un solo gen. Los trastornos autosómicos recesivos de un solo gen ocurren en individuos con mutaciones en ambos alelos de un gen (es decir, individuos que son homocigotos para la mutación). Un individuo con una sola copia del alelo mutante (es decir, individuos que son heterocigotos para la mutación) se denomina portador del trastorno. Ejemplos de trastornos de un solo gen autosómico recesivo incluyen fibrosis quística y hemoglobinopatías. Los trastornos autosómicos dominantes de un solo gen requieren una sola copia del alelo mutante y, por lo tanto, ocurren tanto en individuos heterocigotos como homocigotos. Los ejemplos de trastornos de un solo gen autosómico dominante incluyen la corea de Huntington y el síndrome de Marfan.

Trastornos recesivos ligados al cromosoma X

29. Los trastornos recesivos ligados al cromosoma X son trastornos genéticos que se producen debido a una mutación en el cromosoma X. Los trastornos recesivos ligados al cromosoma X ocurren en hombres que son hemicigóticos para la mutación genética (ya que los hombres poseen un solo cromosoma X) o en mujeres que son homocigotos para la mutación genética (es decir, ambas copias de sus cromosomas X poseen la mutación). Sin embargo, generalmente son los hombres los que se ven afectados por los trastornos recesivos ligados al cromosoma X, en parte debido a la mayor probabilidad de heredar una sola copia de la mutación que de heredar dos copias. Ejemplos de trastornos recesivos ligados al cromosoma X incluyen hemofilia, distrofia muscular de Duchenne y síndrome de X frágil.

30. La presencia de una variación en el número de cromosomas del complemento habitual (es decir, 46 cromosomas) se denomina aneuploidía. La ausencia de un solo cromosoma de un par habitual se denomina monosomía, y la presencia de una copia adicional de un solo cromosoma en un par habitual se denomina trisomía. El cromosoma adicional puede ser independiente o puede estar unido a otro cromosoma. El cromosoma adicional puede heredarse por vía paterna o materna. La forma más común de aneuploidía (trisomía del cromosoma 21) resulta en el síndrome de Down.

31. La sangre completa contiene glóbulos y una porción líquida. Las células sanguíneas incluyen eritrocitos (glóbulos rojos) que transportan oxígeno, células inmunes llamadas leucocitos o glóbulos blancos y trombocitos (plaquetas), que regulan la coagulación de la sangre. Los eritrocitos maduros están anucleados, es decir, no contienen núcleo ni ADN cromosómico. Los glóbulos rojos nucleados inmaduros también se encuentran en la sangre de los fetos, pero se eliminan rápidamente del torrente sanguíneo después del nacimiento.

32. La porción líquida de sangre puede obtenerse como plasma, cuando la muestra de sangre se trata con un anticoagulante, o suero, cuando se permite que la sangre coagule. El plasma es un líquido amarillo pajizo que contiene agua, proteínas del plasma sanguíneo (incluidos los factores de coagulación), ADN libre de células y minerales, así como nutrientes disueltos (como glucosa, aminoácidos y ácidos grasos) y productos de desecho (como urea y ácido láctico).

33. La sangre total puede separarse por centrifugación (que se describe con más detalle a continuación), que en términos generales y dependiendo de las condiciones experimentales da como resultado la formación de tres capas: (i) la capa de plasma superior (ii) la leucocitaria intermedia capa de recubrimiento, que contiene leucocitos y trombocitos y (iii) la capa inferior, que contiene eritrocitos. El ADN cromosómico se puede extraer de la capa leucocitaria, que contiene células nucleadas, y de la capa de plasma, que contiene ADN libre de células.

34. Los fragmentos de ácidos nucleicos libres de células, incluido el ADN, están presentes en el plasma sanguíneo y el suero de los seres humanos. Los ácidos nucleicos libres de células pueden provenir de diversas fuentes, incluida la muerte celular.

35. La necrosis es un mecanismo de muerte celular que surge debido a infecciones, toxinas o traumatismos. La necrosis implica la pérdida de la integridad de la membrana celular y la liberación incontrolada de los productos de la muerte celular.

36. La apoptosis (o muerte celular programada) es un proceso de muerte celular altamente regulado que puede iniciarse a través de varias vías de señalización. La apoptosis se caracteriza por una morfología celular característica, que incluye: (i) ampollas (la formación de protuberancias en la membrana celular conocidas como ampollas) (ii) contracción celular (iii) condensación nuclear (picnosis) y fragmentación (cariorrexis) (iv) condensación de cromatina y (v) fragmentación del ADN cromosómico.

37. Después de la fertilización de un óvulo (huevo) por un espermatozoide en las trompas de Falopio, el cigoto unicelular resultante viaja por la trompa de Falopio y se divide para formar un blastocisto. Aproximadamente cinco días después de la fertilización, el blastocisto, que consta de células trofoblásticas y células embrionarias, llega al útero y se incrusta en el endometrio (revestimiento) del útero.

38. Las células del trofoblasto, que rodean a las células embrionarias, proliferan y se incrustan más en el revestimiento del útero, formando finalmente la placenta (que se describe a continuación). El blastocisto se implanta por completo aproximadamente entre 7 y 12 días después de la fertilización.

39. Al comienzo de la segunda semana, comienza la formación del saco amniótico lleno de líquido. El desarrollo fetal tiene lugar en el saco amniótico, que amortigua al feto y le proporciona flotabilidad.

40. La placenta es una estructura compuesta formada por tejidos maternos y derivados del feto. Los vasos sanguíneos fetales se extienden hasta la placenta a través del cordón umbilical y se ramifican en muchas vellosidades coriónicas, proporcionando una gran superficie para el intercambio de materiales entre la sangre fetal y materna a través de una capa de tejido llamada membrana placentaria. Una variedad de materiales, incluidos nutrientes y oxígeno, se intercambian entre el sistema circulatorio materno y el feto a través de las vellosidades coriónicas en la placenta y el cordón umbilical. Otros materiales que pasan del feto o la placenta a la circulación sanguínea materna incluyen células sanguíneas fetales, proteínas y hormonas que forman la base de la prueba de la enfermedad Rh. Asimismo, los materiales de desecho se eliminan del feto a la circulación materna.

Enfermedad hemolítica por Rhesus

41. El factor Rhesus (Rh) (también conocido como antígeno Rh D) es una proteína que se encuentra en la superficie de los glóbulos rojos en los llamados individuos Rh positivos. Los individuos Rh negativos carecen de esta proteína. La falta de esta proteína en individuos Rh negativos es causada por una deleción o mutaciones del gen (RhD) que la codifica en ambas copias del cromosoma 1. Si una copia del cromosoma 1 contiene el gen RhD y la otra no, el individuo aún expresa factor Rh y se considera Rh positivo.

42. La enfermedad Rh puede causar enfermedad hemolítica del feto, que en casos graves puede resultar en muerte fetal por anemia. Este problema suele surgir en un segundo o en embarazos posteriores cuando una madre Rh negativa está embarazada de un feto Rh positivo. En otras palabras, el niño hereda de su madre una copia del cromosoma 1 en el que el gen RhD está eliminado o mutado y una copia del cromosoma 1 del padre en el que está presente el gen RhD. Dado que el niño posee una copia funcional del gen RhD, el niño produce factor Rh y, por lo tanto, se lo conoce como Rh positivo.

43. Cuando una madre Rh negativa tiene un feto Rh positivo, el feto expresa el factor Rh en sus glóbulos rojos. Durante el embarazo y el parto, la madre puede estar expuesta a los glóbulos rojos fetales que expresan el factor Rh. La madre genera una respuesta inmune al factor Rh, que identifica como extraño, y así su sistema inmunológico se sensibiliza al factor Rh. Una madre Rh negativa sensibilizada al factor Rh puede generar una respuesta inmune que destruya los glóbulos rojos de un feto Rh positivo en embarazos posteriores.

44. La enfermedad Rh se puede prevenir mediante el uso de una prueba no invasiva para determinar el estado Rh del feto y el tratamiento de todas las madres Rh negativas que tienen fetos Rh positivos durante el embarazo y / o inmediatamente después del parto con anticuerpos anti-factor Rh (llamados profiláctico anti-D), asegurando que cualquier glóbulo rojo fetal Rh positivo esté enmascarado antes de que el sistema inmunológico de la madre pueda generar una respuesta inmune contra ellos, evitando así problemas con embarazos Rh positivos subsecuentes.

Análisis citogenético de células fetales.

45. Las técnicas citogenéticas analizan el número y la estructura de los cromosomas. Incluye técnicas como el cariotipo y la hibridación in situ fluorescente (FISH) que permiten identificar anomalías cromosómicas como las trisomías mediante la visualización de los cromosomas en las células fetales. El cariotipo de un individuo es el número y apariencia de los cromosomas en el núcleo de sus células.

46. ​​El cariotipo implica la tinción de los cromosomas con un tinte para poder verlos con un microscopio óptico. Los cromosomas individuales pueden identificarse por su longitud, la posición del centrómero (la parte del cromosoma en la que se unen los dos brazos) y el patrón de bandas en los brazos del cromosoma. Por tanto, el cariotipo permite identificar anomalías cromosómicas, como trisomías autosómicas, debido a la presencia de cromosomas adicionales. El cariotipo también se puede utilizar para identificar trastornos que surgen de la pérdida o translocación de grandes secciones de cromosomas (generalmente más de 2 Mb).

47. FISH utiliza sondas de ADN monocatenario marcadas con fluorescencia diseñadas para complementar y unirse a la parte del gen de interés. La sonda se une a secuencias complementarias en cromosomas específicos, lo que permite visualizar estas secuencias complementarias de interés mediante microscopía de fluorescencia. Por tanto, la presencia de trisomía 21 puede detectarse mediante el uso de una sonda específica del cromosoma 21. La presencia de tres manchas fluorescentes en la célula fetal, en lugar de las dos que estarían presentes en una célula normal (diploide), indica trisomía. Este procedimiento normalmente se lleva a cabo en varias células de una muestra para garantizar un resultado repetible.

Muestreo de vellosidades coriónicas

48.El muestreo de vellosidades coriónicas (CVS) es un método para la recolección de células placentarias que probablemente tengan el mismo cariotipo que el feto. La muestra se toma de las vellosidades coriónicas de la placenta, ya sea: (i) usando un catéter que se inserta a través de la vagina y el cuello uterino para llegar a la placenta (CVS transcervical) o (ii) usando una aguja que se inserta a través del abdomen de la madre en la placenta bajo la guía de una ecografía (CVS transabdominal). Después de la recolección, se realizan controles para asegurarse de que las células son de vellosidades coriónicas y no de tejido materno, y luego las células se cultivan y se someten a análisis citogenético (ver sección L, arriba).

49. La CVS se realiza típicamente durante el primer trimestre del embarazo. El riesgo de pérdida del embarazo derivado de la CVS se suele citar a las pacientes que se encuentran en el límite superior del rango, aproximadamente el 1%.

50. La amniocentesis implica la recolección de líquido amniótico, que contiene células fetales, mediante una aguja que se inserta a través del abdomen y el útero en el saco amniótico bajo la guía de una ecografía. Después de la recolección, las células fetales se cultivan y se someten a análisis citogenético.

51. La amniocentesis generalmente se realiza durante el segundo trimestre del embarazo. El riesgo de pérdida del embarazo derivado de la amniocentesis se suele citar a las pacientes que se encuentran en el límite superior del rango, aproximadamente el 1%.

Muestreo de sangre y tejido fetal

52. El muestreo de tejido y sangre fetal implica la recogida de muestras de tejido o sangre fetal. Las muestras de sangre fetal se pueden recolectar usando una aguja que se inserta en el cordón umbilical o en la vena intrahepática del feto bajo la guía de una ecografía. Se pueden obtener muestras de tejido fetal, incluidas muestras de piel, pulmón, hígado y riñón, utilizando técnicas de biopsia fetal bajo guía fetoscópica o ultrasónica.

53. La toma de muestras de sangre y tejido fetal se puede realizar durante el segundo trimestre del embarazo, pero generalmente se evita en la práctica debido al alto riesgo de pérdida del embarazo y porque los diagnósticos generalmente se pueden hacer utilizando líquido amniótico o material CVS.

54. En 1997, el profesor Dennis Lo y sus colegas descubrieron que el plasma sanguíneo y el suero de las mujeres embarazadas contienen ADN libre de células materno y fetal (Lo et al, Presence of fetal DNA in maternal plasma and serum, Lancet, 350, 485-87 (1997). Al año siguiente, el grupo del profesor Lo demostró que el ADN libre de células fetales estaba presente en cantidades mucho más altas en el plasma y el suero maternos que las células fetales en la sangre materna y que el ADN libre de células fetales podía detectarse ya en el séptimo año. semana de gestación y aumentó en concentración a partir de entonces (Lo et al, Análisis cuantitativo de ADN fetal en plasma y suero maternos: Implicaciones para el diagnóstico prenatal no invasivo, Am J Hum Genet, 62, 768-775 (1998), Lo 1998). Estos hallazgos abrió la posibilidad de utilizar ADN libre de células fetales para el diagnóstico prenatal no invasivo de rasgos genéticos fetales.

55. En octubre de 2003, las aplicaciones clínicas basadas en el análisis de ADN libre de células fetales se centraron en la detección cualitativa de ADN fetal heredado por el padre que no estaba presente en el genoma materno. Dichas aplicaciones incluían pruebas de género en embarazos con riesgo de trastornos ligados al cromosoma X mediante la detección de secuencias del cromosoma Y, identificación de embarazos con riesgo de enfermedad hemolítica RhD mediante la detección del gen RhD en el plasma o suero de madres RhD negativas, diagnóstico de enfermedades ligadas al antígeno leucocitario humano (HLA), como la hiperplasia suprarrenal congénita, mediante la detección de genes HLA fetales y la detección de enfermedades resultantes de mutaciones heredadas por el padre, como la β-talasemia.

Reacción en cadena de la polimerasa

56. La reacción en cadena de la polimerasa (PCR) es una técnica mediante la cual se puede amplificar una secuencia de ADN (es decir, se pueden generar múltiples copias de esa secuencia) a partir de una secuencia de ADN molde. La PCR utiliza una ADN polimerasa termoestable (que es una enzima que produce nuevas cadenas de ADN) y cebadores cortos de ADN monocatenarios que se requieren para el inicio de la síntesis de ADN. Para amplificar la secuencia diana, la reacción tiene lugar en presencia de un exceso de dNTP libres (desoxiadenosina-trifosfato, desoxicitidina-trifosfato, desoxiguanosina-trifosfato y desoxitimidina-trifosfato) en la mezcla de reacción. Los desoxinucleótidos son incorporados por la ADN polimerasa en la generación de las nuevas cadenas de ADN, con la liberación de una molécula de pirofosfato.

57. Las aplicaciones de PCR utilizan ciclos térmicos, por lo que los siguientes pasos constituyen un ciclo de PCR y se llevan a cabo repetidamente:

i) paso de desnaturalización: la muestra de reacción se calienta para provocar la fusión del ADN, por lo que las cadenas de ADN se separan para producir moléculas de ADN de plantilla monocatenarias

ii) etapa de hibridación: la muestra de reacción se enfría para permitir la hibridación / unión de los cebadores de ADN a regiones del ADN molde monocatenario que son complementarias en secuencia a los cebadores y

iii) etapa de elongación: la temperatura de la muestra de reacción se eleva a una temperatura a la que la ADN polimerasa está activa y los cebadores se extienden mediante la incorporación de un nucleótido tras otro de una manera dependiente del molde, lo que da como resultado la síntesis de ADN de una nueva cadena de ADN complementaria a la hebra de la plantilla de ADN.

58. La amplificación de nuevas cadenas de ADN es teóricamente exponencial (se duplica con cada ciclo), ya que cada nueva cadena forma una plantilla para la siguiente ronda de síntesis. Sin embargo, en realidad, este no será el caso porque las condiciones de reacción no óptimas significarán que la eficiencia de la reacción de PCR es típicamente inferior al 100%. La eficiencia de la reacción de PCR variará dependiendo de muchos factores, incluidas las temperaturas de hibridación y extensión, la polimerasa y las condiciones del tampón (concentraciones iónicas).

59. Los cebadores de ADN deben diseñarse para unirse a cadenas de ADN opuestas y flanquear la diana de interés e iniciar la síntesis de una nueva cadena de ADN complementaria a la secuencia diana de cada cadena molde. Estos pares de cebadores se denominan comúnmente cebadores directos e inversos.

60. PCR cuantitativa (qPCR) es un término utilizado para describir el uso de PCR para cuantificar ácidos nucleicos. Se puede lograr mediante varios procedimientos, uno de los cuales es la PCR cuantitativa en tiempo real. La PCR cuantitativa en tiempo real implica una PCR durante la cual se monitorea la acumulación del producto de PCR amplificado midiendo una señal creada por colorantes fluorescentes (como SYBR Green) o sondas fluorescentes (como sondas TaqMan) en la muestra de reacción para generar una amplificación. curva. Describiré qPCR con más detalle a continuación.

61. La electroforesis en gel es una técnica para el análisis de una mezcla de moléculas (como proteínas o fragmentos de ADN), que implica el uso de una corriente eléctrica para pasarlas a través de una matriz de gel sólida, normalmente compuesta de agarosa o poliacrilamida. La velocidad a la que los fragmentos de ADN pasan a través del gel depende de varios factores, incluida su longitud, y los fragmentos de ADN más cortos pasan a través del gel más rápidamente que los fragmentos más grandes. El gel se puede teñir con un tinte tal como bromuro de etidio, que fluoresce bajo luz ultravioleta cuando se intercala con el ADN, lo que permite visualizar los fragmentos de ADN en el gel. El tamaño de los fragmentos de ADN en la muestra puede determinarse mediante el uso de una escalera de referencia que contenga una mezcla de fragmentos de ADN de tamaños conocidos (consulte la Figura 11 a continuación). La electroforesis en gel, seguida de la escisión de una o más regiones del gel y la extracción del ADN contenido dentro de la región o regiones escindidas, puede usarse para aislar fragmentos de ADN de tamaños particulares.

62. La centrifugación es una técnica que permite separar las partículas de una solución en función de su tamaño, forma y densidad sometiendo la solución a una fuerza centrífuga mediante centrifugación en una centrífuga. La correlación entre el tamaño y la densidad de una partícula y la velocidad a la que se separará de la mezcla bajo la fuerza centrífuga permite que las partículas de diferente tamaño y densidad se separen aplicando diferentes grados de fuerza centrífuga variando la velocidad de la centrífuga. La velocidad de centrifugación se especifica típicamente en términos de revoluciones por minuto (RPM) o en términos de la fuerza centrífuga aplicada a la muestra medida en unidades gravitacionales (g).

63. La Patente es un documento refrescante y breve. La especificación comienza en [0001] refiriéndose al hallazgo (del Prof. Lo) de que la sangre de una mujer embarazada contiene ADN extracelular del feto que puede detectarse en el plasma o suero materno, y que esto puede usarse para detectar la genética fetal. loci que están ausentes del genoma materno. En la memoria descriptiva se indica que la determinación de loci genéticos fetales más complejos es más difícil porque la proporción principal (generalmente mayor del 90%) de ADN extracelular en la circulación materna proviene de la madre. Esta gran masa de ADN extracelular circulatorio materno hace que sea difícil, si no imposible, detectar ciertas alteraciones genéticas fetales.

64. A continuación, la especificación presenta la invención de la siguiente manera:

Un examen del ADN fetal extracelular circulatorio y del ADN materno extracelular circulatorio en el plasma materno ha demostrado ahora que, sorprendentemente, la mayoría del ADN fetal extracelular circulatorio tiene un tamaño relativamente pequeño de aproximadamente 500 pares de bases o menos, mientras que la mayoría de los El ADN materno extracelular circulatorio en el plasma materno tiene un tamaño superior a aproximadamente 500 pares de bases. De hecho, en ciertos casos, el material de ADN circulatorio que es menor de aproximadamente 300 pares de bases parece ser casi completamente fetal. Por tanto, se ha encontrado que el ADN fetal extracelular circulatorio en la circulación materna es de tamaño más pequeño (aproximadamente 500 pares de bases o menos) que el ADN materno extracelular circulatorio (más de aproximadamente 500 pares de bases).

Este hallazgo sorprendente forma la base de la presente invención según la cual la separación de fragmentos de ADN extracelular circulatorio que son más pequeños que aproximadamente 500 pares de bases o menos proporciona la posibilidad de enriquecer las secuencias de ADN fetal a partir de la gran mayoría del ADN materno extracelular circulatorio. .

Este enriquecimiento selectivo, que se basa en la discriminación de tamaño de los fragmentos de ADN circulatorio de aproximadamente 500 pares de bases o menos, conduce a una fracción que está constituida en gran parte por ADN extracelular fetal. Esto permite el análisis de rasgos genéticos fetales, incluidos los implicados en aberraciones cromosómicas (por ejemplo, aneuploidías o aberraciones cromosómicas asociadas con el síndrome de Down) o trastornos genéticos mendelianos hereditarios y, respectivamente, marcadores genéticos asociados con ellos (por ejemplo, trastornos de un solo gen como la fibrosis quística o las hemoglobinopatías). ), cuya determinación, como se mencionó anteriormente, hasta ahora había resultado difícil, si no imposible. La separación del tamaño del ADN fetal extracelular en la circulación materna facilita la detección no invasiva de rasgos genéticos fetales, incluidos los polimorfismos heredados por el padre que permiten las pruebas de paternidad.

65. Habiendo reconocido dos elementos del estado de la técnica y establecido un párrafo del consistorio, la especificación continúa:

La fracción de muestra así obtenida no solo permite la posterior determinación de rasgos genéticos fetales que ya habían sido fácilmente detectables de manera convencional como el gen RhD fetal en embarazos con riesgo de HDN (enfermedad hemolítica del feto y del recién nacido). ), o secuencias específicas del cromosoma Y fetal en embarazos con riesgo de un trastorno ligado al cromosoma X, como hemofilia, síndrome de X frágil o similares, pero también la determinación de otros loci genéticos fetales más complejos, incluidos, entre otros,

- aberraciones cromosómicas (por ejemplo, aneuploidías o síndrome de Down) o trastornos genéticos mendelianos hereditarios y, respectivamente, marcadores genéticos asociados con ellos (por ejemplo, trastornos de un solo gen como la fibrosis quística o las hemoglobinopatías)

- rasgos genéticos fetales que pueden ser determinantes a la hora de determinar la paternidad.

Tal determinación de rasgos genéticos fetales puede realizarse mediante métodos tales como, por ejemplo, tecnología de PCR (reacción en cadena de la polimerasa), reacción en cadena de ligasa, técnicas de hibridación de sondas, matrices de ácidos nucleicos (denominados chips de ADN) y similares.

66. Hay dos ejemplos. El ejemplo 1 se describe en [0011] - [0021]. En resumen, este informa el siguiente estudio. Se reclutaron siete mujeres con embarazos en el tercer trimestre con un feto masculino. Se recogieron muestras de sangre y se centrifugaron dos veces (primero a 1600 g durante 10 minutos y luego se retiró el sobrenadante y se centrifugó a 16.000 g durante 10 minutos). Se extrajo ADN de la muestra de plasma y se precipitó. A continuación, este ADN se separó mediante electroforesis en gel, tras lo cual el gel se cortó en trozos según los marcadores de tamaño. Los trozos de gel resultantes contenían fragmentos de longitudes de 90-300 pb (pares de bases), 300-500 pb, 500-1000 pb, 1000-1500 pb, 1500 pb-23 kb y mayores de 23 kb. El ADN se purificó a partir de los trozos de gel. Finalmente, se usó qPCR para cuantificar el ADN fetal (usando el gen SRY, tamaño de amplicón de 78 pb) y el ADN total (usando el gen GAPDH, tamaño de amplicón de 97 pb) en cada pieza de gel.

67. Los resultados de cinco embarazos se presentan en el cuadro 1 como sigue:

68. La segunda columna establece los porcentajes de ADN fetal en cada pieza del gel. La tercera columna establece los porcentajes de ADN materno en cada pieza del gel. La especificación explica en [0021] que las cifras en la segunda y tercera columnas son los valores medianos de los porcentajes y, entre paréntesis, los rangos.

69. La especificación comenta estos resultados de la siguiente manera:

La Tabla 1 muestra que en los cinco embarazos examinados, los fragmentos de ADN procedentes del feto eran casi completamente de tamaños menores de 500 pares de bases, siendo alrededor del 70% de origen fetal para tamaños menores de 300 pares de bases.

Estos resultados demuestran que el ADN libre de origen fetal que circula en la circulación materna puede enriquecerse específicamente mediante la separación por tamaño del ADN libre total en la sangre materna. Dependiendo de la aplicación posterior, el tamaño del ADN elegido para el enriquecimiento del ADN fetal será menor de 300 o menor de 500 bases.

70. La especificación no muestra cuál era la fracción fetal antes de la separación por tamaño. Suponiendo que estuviera dentro del rango publicado en Lo 1998 para embarazos en el tercer trimestre de 2% a 11%, el lector experto comprendería que la fracción fetal se había enriquecido tanto en 10 como en> 23 kb (Fig. 1). La presencia de este tipo de especies de ADN de alto peso molecular no puede atribuirse a que la muestra de plasma esté contaminada por células maternas porque hemos tenido sumo cuidado para obtener muestras de plasma libres de células.

223. Los autores también dicen (en la página 1008):

Con respecto a la distribución de tamaño del ADN circulatorio total, determinamos que el patrón que habíamos observado en mujeres embarazadas era muy similar al observado en muestras tomadas de mujeres no embarazadas así como de voluntarios varones sanos (Fig. 4). En ninguno de estos análisis pudimos detectar grandes cantidades de ADN con un tamaño molecular mayor que el indicado por el marcador de peso molecular de 23 kb, en contraste con lo que observamos en nuestro análisis de transferencia Southern (Fig. 1). La razón de esta anomalía puede ser que estos grandes fragmentos no se eluyen fácilmente del gel de agarosa en las condiciones que estamos usando, a diferencia de la transferencia Southern, donde el ADN se trata primero con álcali para generar los pequeños fragmentos necesarios para una transferencia capilar eficiente. .

224. Aunque los autores afirman que tomaron sumo cuidado para evitar la contaminación de las muestras de células maternas, la opinión del Prof. Thierry fue que habían sido contaminadas significativamente por ADN genómico de la lisis de células maternas. Si bien Li 2004 utilizó un paso de centrifugación doble, había otras fuentes de dicha contaminación, y desde 2003/4 se había avanzado en el conocimiento de cómo evitar dicha contaminación.

225. Si el profesor Thierry está en lo cierto en cuanto a la proporción de ADN de más de 23 kb en la Figura 1, esto significaría que es probable que los datos de las Tablas 1 y 2 de Li 2004 representen significativamente menos la proporción de ADN de más de 23 kb (y, por lo tanto, más de 500 pb ) que estaba presente en las muestras.

226. El profesor Thierry estimó que la proporción de fragmentos que se encuentran en la banda de aproximadamente 23 kb es el 50% del total. El profesor Lovett señaló que esto no tuvo en cuenta el hecho de que la sonda era para una secuencia repetitiva, lo que significa que la intensidad de la banda no es proporcional al número de fragmentos (como lo sería para una sonda que se une a una copia genómica de una sola copia). secuencia). El profesor Lovett no fue cuestionado por esta evidencia. En cambio, el punto que se le planteó al profesor Lovett en el contrainterrogatorio fue que su opinión de que la proporción era mucho menos del 50% era inconsistente con lo que los autores de Li habían dicho acerca de que hay una 'proporción sustancial o grandes cantidades de ADN mayor de 20kb. Señaló que dependía de lo que Li 2004 quisiera decir con "proporción sustancial o grandes cantidades, su estimación fue quizás un pequeño porcentaje".

227. El profesor Thierry se vio obligado a admitir que el profesor Lovett tenía razón en que la naturaleza de copia múltiple de las repeticiones de Alu, a las que se unirá la sonda de Alu utilizada en la mancha Southern, magnificaría enormemente la oscuridad de cualquier fragmento dado en la parte superior de la mancha. , lo que significa que el número relativo de fragmentos no se puede estimar simplemente mirando la oscuridad de las bandas. En su defensa, dijo que la proporción del 50% era solo una estimación, pero a mi juicio se deduce que su estimación no era confiable.

228. El profesor Thierry cambió de opinión y dijo que había comparado genomas, mientras que el profesor Lovett había comparado fragmentos. Más tarde, dijo que esta era la comparación correcta porque el ADN circulatorio provenía de las células, aunque no explicó claramente por qué. No hay duda de que el profesor Lovett había comparado fragmentos. No se le planteó que se había equivocado al hacerlo, y mucho menos se le planteó el punto del profesor Thierry sobre los genomas (lo que fuera). Además, como señalaron los abogados de las Demandantes, esta prueba parece ser contraria a las declaraciones hechas en la nota al pie 21 del primer informe del Prof. Thierry, que indican que estaba comparando fragmentos.

229. Por lo tanto, acepto la evidencia del profesor Lovett de que la proporción de fragmentos de alrededor de 23 kb es mucho menos del 50%.

230. Se acuerda que, si las cifras que figuran en los cuadros 1 y 2 de Li 2004 se toman al pie de la letra, el grado de enriquecimiento del ADN fetal logrado mediante la separación por tamaño a 500 pb sería 1,9 veces para los cuadros 1 y 1.8. tiempos para la Tabla 2. La opinión del profesor Thierry, basada en su estimación del 50% para fragmentos de alrededor de 23 kb que no están incluidos en las tablas, fue que las cifras reales eran alrededor de 3,8 y 3,5 veces. Por las razones expuestas anteriormente, no acepto la cifra del 50%. Las Demandantes aceptan que la Figura 1 muestra que hay algo de ADN de alrededor de 23 kb presente y, como consecuencia, el grado de enriquecimiento del ADN fetal como resultado de la separación de tamaños sería mayor que lo que indican los datos reportados en la Tabla 2 de Li 2004, porque la tabla no tiene en cuenta el ADN en alrededor de 23 kb (como señaló el profesor Lovett, la tabla 1 no está necesariamente en la misma posición, porque tanto la figura 1 como la tabla 2 se relacionan con el embarazo temprano, mientras que la tabla 1 se relaciona con el embarazo tardío) .

231. La opinión del profesor Thierry fue que el enriquecimiento de 3,8 y 3,5 veces no era creíble y que, como se discutió anteriormente, la explicación más probable de los resultados era la contaminación de las muestras. Sin embargo, a mi juicio, las pruebas no establecen que el grado de enriquecimiento en Li 2004 sea significativamente mayor que el indicado por los datos comunicados. El profesor Thierry puede tener razón en que, a pesar de que los autores afirman que tomaron sumo cuidado, existía cierta contaminación que hoy en día podría evitarse con mejores métodos de manipulación de muestras. Sin embargo, no estoy satisfecho de que hubiera un grado significativo de contaminación.

232.En cualquier caso, como señalan las Demandantes, nada en Li 2004 socava la proposición de que existe una diferencia entre la distribución del tamaño del ADN libre de células fetales y la distribución del tamaño del ADN libre de células maternales que permite enriquecer la fracción fetal. a través de la separación de tamaños a 500 pb. La única pregunta es en qué medida se puede lograr el enriquecimiento.

233. Cheng et al, Noninvasive Prenatal Testing by Nanopore Sequencing of Maternal Plasma DNA: Faasibility, Clin Chem, 61 (10), 1305-1306 (2015) (Cheng 2015) informa un estudio que utiliza un dispositivo de secuenciación de nanoporos llamado MinION para secuenciar ADN libre de células de mujeres embarazadas de fetos masculinos (tercer trimestre), mujeres embarazadas de fetos femeninos (tercer trimestre), mujeres no embarazadas y hombres. La longitud máxima de los fragmentos secuenciados fue de 5776 pb.

234. Cheng 2015 informa que el 0,06% 0,3% de las lecturas de secuencia son superiores a 1000 pb (aunque no dice con respecto a qué muestra (s) podría haber sido con respecto a mujeres no embarazadas). No da ninguna cifra para la proporción de lecturas que fueron superiores a 500 pb, por lo que no hay forma de saber cuántas encontró entre 500 y 1000 pb.

235. La evidencia del profesor Lovett, basada en un artículo de Laver et al, fue que el dispositivo MinION está fuertemente sesgado hacia la secuenciación de fragmentos cortos. Se le sugirió que el gráfico en Laver que muestra este sesgo no explica por qué la proporción de fragmentos por encima de 1 kb encontrados por Cheng 2015 es menor que el 7,5% de ADN en la banda de 1-1,5 kb informada por Li 2004. Respuesta del profesor Lovett era que no había forma de saber cómo se había ajustado el MinION utilizado en Cheng 2015 para sus ejecuciones de secuenciación, ya que la distribución de tamaño que da se puede cambiar.

236. El abogado de las Demandantes sostuvo que las incertidumbres sobre los datos de Cheng 2015, que se generaron utilizando una tecnología diferente que apenas se había explorado en la evidencia, no proporcionaron base para concluir que hay poco o ningún ADN libre de células en la madre. plasma que es superior a 500 pb dado que se sabe por Chan 2004 que existe dicho ADN. Acepto esta sumisión.

237. Además de los tres artículos considerados anteriormente, el profesor Thierry presentó tres figuras que contienen electroferogramas en apoyo de su propuesta de que hay poco ADN libre de células maternas por encima de 500 pb (Figuras 1-3 en su segundo informe). El abogado de los acusados ​​no se basó en esta evidencia en sus alegatos finales, pero me ocuparé de ella para que esté completa.

238. Los gráficos 2 y 3 no se refieren a muestras de mujeres embarazadas, por lo que no son probatorios, dado que Chan 2004 mostró una diferencia significativa entre mujeres embarazadas y no embarazadas. Eso deja la Figura 1, que muestra un perfil de tamaño de una sola mujer embarazada. Esto utilizó una técnica para la cual el rango de tamaño era solo de hasta 7 kb y, en cualquier caso, una sola muestra apenas proporciona ninguna base para cuestionar los datos estadísticamente confiables en Chan.

239. Como señalaron los abogados de los Demandantes, es difícil entender por qué los Demandados dicen que existe un apretón entre la construcción y la insuficiencia de tal manera que, a menos que las reclamaciones se limiten al enriquecimiento de al menos 2,0 veces, son insuficientes. No parece haber conexión entre el argumento de los Demandados de que los resultados informados en la Patente son exagerados debido a la contaminación y el problema de la construcción.

240. Sea como fuere, he llegado a la conclusión de que las reivindicaciones no se limitan al enriquecimiento de al menos 2,0 veces, sino que abarcan un grado menor de enriquecimiento. Así interpretado, no acepto que las reivindicaciones sean más amplias de lo que está justificado por la contribución técnica hecha por la Patente. La patente describe un principio general de utilidad técnica, a saber, que el ADN libre de células fetales en el plasma o suero materno puede enriquecerse mediante separación por tamaños a 500 pb. La amplitud de las reclamaciones está en consonancia con esa contribución técnica. Es indiferente que el grado de enriquecimiento que se puede lograr puede variar de un caso a otro y puede ser, en promedio, menos de 2,0 veces.

241. El abogado de los Demandados sostuvo que la excesiva amplitud de las reclamaciones se demostró por el hecho de que habría casos en los que apenas habría ADN libre de células de más de 500 pb en el plasma materno. El abogado de las Demandantes aceptó que podría haber casos de este tipo, aunque afirmó que, según las pruebas, es probable que sean muy raros, con lo que estoy de acuerdo. Sin embargo, como he interpretado las afirmaciones, no cubren las fracciones derivadas de dichas muestras de plasma. No acepto que las afirmaciones sean insuficientes incluso si se interpretan como que abarcan fracciones derivadas de dichas muestras. El hecho de que en muy raras ocasiones la invención no tenga ningún beneficio práctico no quita que en la gran mayoría de los casos sea de utilidad técnica.

242. Los Demandados sostienen que, incluso si son válidas de otro modo, las invenciones reivindicadas están excluidas de la patentabilidad en virtud del artículo 1 (2) (a) de la Ley de 1977 sobre la base de que son descubrimientos. Los Demandados aceptan, sin embargo, que, tal como está vigente en la actualidad, este argumento no puede prosperar. Piden a la Corte que haga determinaciones de hecho apropiadas para permitir que la cuestión de la ley sea discutida en un tribunal superior si es necesario. Las Demandantes se opusieron a este curso, sobre la base de que no era posible juzgar la pertinencia y exactitud de las conclusiones de hecho propuestas sin saber qué análisis legal pretendían avanzar las Demandas basándose en ellas. Al menos en ausencia de una explicación del análisis legal de los Demandados, los hechos propuestos fueron controvertidos.

243. Basta ilustrar el punto con referencia a la primera conclusión de hecho propuesta por los Demandados, que se expresa en los siguientes términos:

La sangre materna y su contenido son productos naturales.

244. Los abogados de las Demandantes aceptaron que la sangre materna era un producto de origen natural, pero impugnaron que su contenido fueran necesariamente productos de origen natural. Esto dependería de a qué contenido se estuviera refiriendo y con qué propósito se estuviera haciendo la pregunta. Por ejemplo, una muestra de plasma era un producto creado artificialmente a pesar de que derivaba de uno de origen natural.

245. Estoy de acuerdo con las Demandantes en que no es satisfactorio que se le pida a la Corte que realice determinaciones de hecho en un vacío legal. Como ilustra el ejemplo que he dado, existe un peligro real de que la Corte se vea inducida a realizar determinaciones cargadas de juicios de valor legal. Además, no se me remitió a ninguna prueba específica en la que se confiara para establecer los hechos propuestos. El abogado de los Demandados simplemente afirmó que las conclusiones propuestas se basaron en la evidencia en su conjunto. En consecuencia, me niego a realizar las conclusiones solicitadas.

246. La prueba Harmony incluye un paso de separación por tamaño como resultado de lo cual el ADN extracelular en las muestras de plasma consiste sustancialmente en ADN que consta de 500 pares de bases o menos. La única cuestión argumentada por los Demandados sobre la infracción se basó en la construcción de enriquecimiento de 2,0 veces que he tratado en los párrafos 112-113 anteriores. Se reconoció que la separación por tamaño da como resultado, en promedio, un enriquecimiento de la proporción de ADN libre de células fetales presente en la muestra. Se acuerda la extensión promedio del enriquecimiento, pero es confidencial. No es necesario que establezca la cifra exacta en esta sentencia, pero es inferior a 2,0. Los Demandados sostienen que una parte sustancial del enriquecimiento se debe a la eliminación del ADN materno contaminante liberado por la lisis celular. Es un hecho común que parte del enriquecimiento se debe a esto. El profesor Lovett proporcionó pruebas indiscutibles de que aproximadamente 1/6 del enriquecimiento era atribuible a este efecto teniendo en cuenta el método de centrifugación empleado. El profesor Thierry sugirió que un factor contribuyente adicional, aunque secundario, era la agitación de las muestras, pero no se demostró que esto hiciera una diferencia mayor de lo que estimó el profesor Lovett. A mi juicio, el hecho de que una pequeña proporción del enriquecimiento se deba a la eliminación del ADN materno contaminante es irrelevante para la cuestión de la infracción. Como he interpretado la reivindicación 1, TDL la ha infringido.


MATERIALES Y MÉTODOS

Cebadores LATE-PCR

Conjuntos separados de cebadores LATE-PCR para EGFR Los exones 18-21 que exhiben eficiencias de cebado similares en las mismas condiciones de amplificación se diseñaron utilizando el software Visual OMP [33] (versión 6.6.0 DNA Software, Inc, Ann Arbor, MI) de acuerdo con los criterios de diseño LATE-PCR [28,29] . Los cebadores LATE-PCR en exceso y limitantes para cada amplicón tenían temperaturas de fusión similares, aproximadamente 72 ° C y 75 ° C, respectivamente, según lo calculado por el software Visual OMP, Tabla I. Las longitudes de los amplicones resultantes se mantuvieron por debajo de 220 nucleótidos para facilitar la amplificación del ADN genómico de baja calidad que normalmente se recupera de muestras clínicas fijadas con formalina e incluidas en parafina [34]. Los cebadores se adquirieron en Biosearch Technologies (Novato, CA, EE. UU.). Los cebadores para los exones 18, 19 y 21 están ubicados en las secuencias de intrones que flanquean cada exón y amplifican las secuencias normales y mutantes para cada exón con una eficacia similar (información complementaria S1). El exón 20 tiene un contenido de GC más alto que los exones 18, 19 y 21 (60%). Para generar un amplicón para el exón 20 con una temperatura de fusión que coincida con la de los otros amplicones, uno de los cebadores del exón 20 se coloca en una región dentro del exón 20 que no tiene mutaciones conocidas según el Catálogo de mutaciones somáticas en cáncer. (COSMIC) base de datos [12]. Los conjuntos de cebadores se optimizaron primero para la especificidad y la eficiencia en las reacciones LATE-PCR de monoplex antes de integrarse en el ensayo multiplex.

Tabla I

Nombre de la cartillaTm
(& # x000b0C)
Secuencia de imprimación
Exón 18 del cebador limitante755 & ​​# x02032 CCCAGAGGCCTGTGCCAGGGACCTTAC 3 & # x02032
Exón 18 del cebador en exceso725 & ​​# x02032 CTTGTCTCTGTGTTCTTGTCCCCCC 3 & # x02032
Exón 19 del cebador limitante755 & ​​# x02032 CCATGGACCCCCACACAGCAAAGCAGAAACTCAC 3 & # x02032
Exón de cebador en exceso 19725 & ​​# x02032 GCCAGTTAACGTCTTCCTTCTCTCTCTGTCATA 3 & # x02032
Exón 20 del cebador limitante745 & ​​# x02032 TGGGAGCCAATATTGTCTTTGTGTTCCCGGACATAGT 3 & # x02032
Exón de cebador en exceso 20725 & ​​# x02032 GTGCCTCTCCCTCCCTCCAG 3 & # x02032
Exón 21 del cebador limitante755 & ​​# x02032 AGGAAAATGCTGGCTGACCTAAAGCCACCTCCTTAC 3 & # x02032
Exón de cebador en exceso 21725 & ​​# x02032 CTCACAGCAGGGTCTTCTCTGTTTCAG 3 & # x02032

Sondas de luces encendidas / apagadas

Se diseñaron cuatro conjuntos de sondas Lights-On / Lights-Off de diferentes colores, uno para cada exón, para hibridar con productos LATE-PCR monocatenarios en el mismo amplio rango de temperatura al final de la amplificación (Tabla II). Cada conjunto abarcó la secuencia sin cebador de un amplicón (datos suplementarios S1). Algunas sondas incluían desajustes de nucleótidos con sus secuencias diana para ajustar la temperatura de fusión de la sonda. Las sondas Lights-On se marcaron con un fluoróforo y un extintor en los extremos opuestos. Algunas sondas Lights-Off contenían un extintor en el extremo 5 & # x02032 y se bloquearon en su extremo 3 & # x02032 con un enlazador C3. Otras sondas Lights-Off contenían solo un extintor en el extremo 3 & # x02032. Algunas sondas Lights-Off particularmente cortas tenían dos restos desactivadores en los extremos opuestos que interactuaban con los restos desactivadores o fluoróforos de las sondas hibridadas de forma adyacente para aumentar la estabilidad de las sondas unidas. Algunas sondas Lights-On fueron diseñadas para tener funciones dobles de encendido / apagado. Estas sondas se hibridan con la diana de manera que el extintor de una sonda es adyacente al fluoróforo de otra sonda Lights-On. Mediante este método, la unión de la segunda sonda de luces encendidas actúa como una sonda de luces apagadas a la sonda de luces encendidas adyacente ya vinculada (información complementaria S1).

Cuadro II

InvestigacionTm
(& # x000b0C)
Secuencia de sonda5 & ​​# x02032 Mod.3 & # x02032 Mod.
Exon18 ENCENDIDO715 & ​​# x02032 GGTTGATCTTTTTGAATTCAGTTTCCTT
CAAGATCCTCCC 3 & # x02032
FAMBHQ-1
Exon18 APAGADO655 & ​​# x02032 CGGAGCCCAGCACT 3 & # x02032BHQ-1BHQ-1
Exon18 ENCENDIDO695 & ​​# x02032 CAAAGAGAGCTTGGTTGGGAGCT
TTG 3 & # x02032
BHQ-1FAM
Exon18 ENCENDIDO595 & ​​# x02032 GGCTCCACTGGGTGTAAGCC 3 & # x02032BHQ-1FAM
Exon18 APAGADO615 & ​​# x02032 AGGCTCCACAAGCTG 3 & # x02032BHQ-1C3
Exon19 ENCENDIDO695 & ​​# x02032 GGACCTTCTGGGATCCAGAGTCC
CCC 3 & # x02032
Cal-RedBHQ-2
Exon19 APAGADO625 & ​​# x02032 ACGGGAATTTTAACTTTCTC 3 & # x02032-BHQ-2
Exon19 ENCENDIDO595 & ​​# x02032 CCGCTTTCGGAGATGTTGCTTGG 3 & # x02032BHQ-2Cal-Red
Exon19 APAGADO575 & ​​# x02032 CTCTTAATTTCTTGATAGCG 3 & # x02032BHQ-2BHQ-2
Exon19 ENCENDIDO625 & ​​# x02032 TTATCGAGGATTTCCTTGTTGGAA 3 & # x02032BHQ-2Cal-Red
Exon20 ENCENDIDO595 & ​​# x02032 GCAGATACCCAGTAGGCGG 3 & # x02032QuásarBHQ-2
Exon20 APAGADO555 & ​​# x02032 CTGCATGGTGAAGGTGAG 3 & # x02032BHQ-2BHQ-2
Exon20 APAGADO645 & ​​# x02032 GCATGAGCCGCGTGATGAG 3 & # x02032BHQ-2BHQ-2
Exon20 ENCENDIDO695 & ​​# x02032 CCAGGGGGCAGCCGAAGG 3 & # x02032BHQ-2Quásar
Exon21 APAGADO505 & ​​# x02032 CCAGCATTATGGCTCGCCC 3 & # x02032BHQ 1C3
Exon21 ENCENDIDO705 & ​​# x02032 TTAAAATCTGTGATCTTGGCATGCTGC
GGTGAA 3 & # x02032
Cal-Or.BHQ-1
Exon21 ENCENDIDO565 & ​​# x02032 TTTTTGTCTCCCCCTGCATGGTATTCT
TAA 3 & # x02032
BHQ-1Cal-Or.
Exon21 APAGADO445 & ​​# x02032 TCTCTTCTGTACCC 3 & # x02032BHQ-1C3
Exon21 ENCENDIDO595 & ​​# x02032 CCACGGTCCCCCAAGTAGTTTATGC
CGG 3 & # x02032
Cal-Or.BHQ-1
Exon21 APAGADO425 & ​​# x02032 CTAGGTCTTGGTGGATTGAGCG 3 & # x02032BHQ-1BHQ-1
Exon21 ENCENDIDO555 & ​​# x02032 CCCACCAGTATGTTCCTGGTTGGG 3 & # x02032BHQ-1Cal-Or.

Abreviaturas : BHQ-1, Black Hole Quencher 1 BHQ-2, Black Hole Quencher 2 C3, C3 spacer linker Cal-Red, Cal-Red 510 Quasar, Quasar 610 Cal-Or., Cal Orange 560.

Las sondas Lights-On / Lights-Off se diseñaron teniendo en cuenta las restricciones únicas impuestas por las secuencias objetivo y las estructuras secundarias de los cuatro EGFR amplicones monocatenarios. Los nucleótidos para los codones 800-823 en el exón 20 no se incluyeron en el amplicón porque esta secuencia forma una estructura secundaria de temperatura de fusión particularmente alta que evita la unión de sondas a temperaturas más bajas. Las sondas Lights-On / Lights-Off se construyeron para unirse a temperaturas por debajo de la temperatura de hibridación del cebador de la reacción (72 & # x000b0C) de acuerdo con los principios LATE-PCR [28]. Las sondas Lights-Off también se diseñaron para unirse a las mutaciones más comunes [6], tener una longitud de 10-15 nucleótidos para mejorar su discriminación de alelos y generar firmas fluorescentes mutantes que se desvían considerablemente de la firma de referencia normal [30]. Las sondas Lights-On tendían a tener una longitud de 20-25 nucleótidos y se usaban preferentemente para unirse a mutaciones poco frecuentes. Las sondas Lights-On de mayor temperatura de fusión también se diseñaron para unir secuencias que podrían formar estructuras secundarias que podrían interferir con la unión de la sonda a temperaturas más bajas. Finalmente, siempre que fue posible, las sondas se colocaron con la intención de generar la firma fluorescente de referencia más simple en objetivos normales. Así, las firmas mutantes se destacaron más claramente en comparación.

El color para cada conjunto de sondas Lights-On / Lights-Off también se eligió de acuerdo con la frecuencia y el impacto de las mutaciones interrogadas. Por tanto, las sondas Lights-On para el exón 18 se marcaron con FAM, el fluoróforo más débil, porque la frecuencia de mutaciones sensibilizadoras de TKI en el exón 18 es relativamente baja, & # x0003c5% [6]. Por el contrario, las sondas Lights-On para el exón 20 se marcaron con el fluoróforo más brillante, Quasar 670, ya que las mutaciones de resistencia a TKI más críticas residen en este exón [6]. Otros detalles sobre el diseño de las sondas Lights-On / Lights-Off se han descrito en otra parte [30,35-37].

Preparación de ADN genómico de líneas celulares cancerosas y biopsias de NSCLC

Varias líneas de células cancerosas que contienen EGFR las mutaciones se adquirieron de la American Tissue Culture Collection (ATCC, Manassas, VA). Los ADN genómicos de estas líneas celulares se prepararon usando Quantilyse, una solución de lisis de proteinasa K optimizada para PCR que consta de Tris-Cl 10 mM pH 8,3, SDS 5 & # x003bcM y proteinasa K 0,1 mg / ml como se describe [38]. Las muestras de ADN resultantes se almacenaron a 4 ° C para evitar la congelación y descongelación. La secuencia de normal y mutante EGFR los exones 18-21 de cada línea celular se confirmaron mediante secuenciación.

ADN genómico normal con varias configuraciones de alelos para el SNP natural rs1050171 [39] en EGFR exón 20 (<"tipo": "entrez-nucleotide", "attrs": <"text": "NG_007726.3", "term_id": "399923581" >> NG_007726.3: g.167339G & # x0003eA) [40 ] se compraron en Coriell Cell Repositories (Camden, Nueva Jersey) o se prepararon a partir de las líneas celulares de cáncer ATCC como se describió anteriormente y se confirmaron mediante secuenciación. Se utilizaron las siguientes muestras: muestras de ADN NA10851 (genotipo AA), NA07348 (genotipo A / G) y NA10855 (genotipo GG) y líneas celulares HCC827 (genotipo AA) y HCC4006 (genotipo GG).

ADN genómico de biopsias de CPCNP incluidas en parafina y fijadas con formalina con secuencias normales conocidas y mutaciones en EGFR los exones 18-21 según lo determinado por COLD-PCR / análisis de secuenciación [18] fueron amablemente proporcionados por el Dr. Khalid Tobal (Unidad de Oncología Molecular, Hospital Guys & # x02019, Londres, Reino Unido). Estas muestras se prepararon y caracterizaron utilizando los métodos descritos por Pennycuick et al. [19].

Condiciones de amplificación LATE-PCR

Las amplificaciones multiplex LATE-PCR se llevaron a cabo en reacciones de 25 & # x003bcl que consisten en tampón Taq de platino 1 & # x000d7 (Invitrogen, Carlsbad, CA), MgCl 3 mM2, 400 & # x003bcM de cada desoxinucleótido trifosfato, 50 nM de cada cebador limitante, 1 & # x003bcM de cada cebador en exceso, 100 nM de cada sonda Lights-On, 300 nM de cada sonda Lights-Off, 2,5 unidades de Platinum Taq DNA polimerasa (Invitrogen, Carlsbad, CA) y 1-1000 copias de ADN genómico. La amplificación se llevó a cabo en un Stratagene MX3500P (Agilent Technologies, Santa Clara, CA) durante 70 ciclos. Cada ciclo consistió en desnaturalización a 99 & # x000b0C durante 10 segundos, hibridación del cebador a 72 & # x000b0C durante 15 segundos y extensión del cebador a 75 & # x000b0C durante 30 segundos; la temperatura de desnaturalización se fijó en 99 & # x000b0C en lugar del habitual 95 & # x000b0C debido a la Tm más alta del componente bicatenario del amplicón del exón 20, 96 & # x000b0C-. Al final de la amplificación hubo un paso de extensión final a 75 ° C durante 3 minutos.Para el análisis de punto final, la reacción se enfrió lentamente desde 85 ° C a 35 ° C a decrementos de 1 ° C cada 30 segundos para permitir la hibridación de las sondas de luces encendidas / apagadas. Después de 10 minutos de incubación a 35 ° C para el equilibrio de las sondas unidas, la reacción se calentó desde 35 ° C a 85 ° C en incrementos de 1 ° C cada 30 segundos con adquisición de fluorescencia en cada grado. Cuando fue necesario, las muestras se prepararon para la secuenciación de didesoxi mediante el método Dilute & # x02018N & # x02019Go [31, 32] y se secuenciaron mediante GeneWiz (South Plainfield, NJ). El análisis de secuencia se realizó utilizando el programa en línea CLUSTAL [41]. Lo normal EGFR las secuencias del exón 18-21 de la secuencia de referencia NCBI <"type": "entrez-nucleotide", "attrs": <"text": "NG_007726.3", "term_id": "399923581" >> NG_007726.3 se utilizaron para comparación con todas las líneas celulares y muestras clínicas. Las deleciones se identificaron en cromatógrafos de secuencia como regiones en las que la secuencia diana eliminada quedó fuera de marco con respecto a la secuencia de referencia.

La concentración de cada sonda Lights-On se estableció en 100 nM, ligeramente más baja que el rendimiento máximo anticipado de amplicones de ADN monocatenario generados en la LATE-PCR a una concentración terminal a 70 ciclos para garantizar la unión completa de todas las sondas Lights-On y minimizar las diferencias entre las firmas fluorescentes replicadas [30,35-37], excepto para el experimento que prueba el límite de detección del ensayo en el que la concentración de cada sonda Lights-On se fijó en 300 nM. La concentración de cada sonda Lights-Off se estableció tres veces más alta que la concentración de la sonda Lights-On para garantizar que cada sonda Lights-On unida tenga una sonda Lights-Off hibridada junto a ella [30,35-37] (es decir., 300 nM para todos los experimentos que se muestran en este documento excepto para el experimento que prueba el límite de detección del ensayo donde fue 600 nM).

Para experimentos que involucran mezclas artificiales de genomas mutantes y normales, el ADN de la línea celular HCC4006 que lleva una deleción sensibilizante de TKI en EGFR El exón 19 se emparejó en concentración con ADN genómico de células normales (según lo confirmado por los valores de Ct generados por amplificación LATE-PCR en tiempo real con SYBR-Gold) y se mezcló en varias proporciones para generar muestras con 50%, 10%, 5%, y 1% de ADN mutante. Cada muestra contenía un total de 10,000 genomas para garantizar que el porcentaje más bajo de genomas mutantes (1%) estaría en números grandes, de modo que cada muestra replicada contendría ADN genómico mutante. Se preparó un conjunto similar de mezclas de genoma normal y mutante para el ADN de la línea celular NCI-H1975 que porta la mutación T790M resistente a TKI.

Análisis de los datos

Las firmas fluorescentes se generaron trazando la primera derivada negativa de las señales fluorescentes sin procesar del análisis de fusión en relación con la temperatura (-dF / dT) en función de la temperatura sin ninguna sustracción de la señal de fondo o normalización de datos [30]. La única excepción fueron los datos de la Figura 5B en los que los valores de la derivada fluorescente se normalizaron al pico más alto de la firma fluorescente que era común a todas las muestras. Para cada exón, las mutaciones se identificaron comparando la forma de la firma fluorescente de la muestra de prueba con la forma de la firma fluorescente de la muestra normal de referencia. Las diferencias en la forma más allá del ruido entre muestras repetidas debido a cambios de temperatura en la posición de los picos y valles de las firmas fluorescentes identificaron la presencia de una mutación [30]. Las diferencias en las intensidades de las firmas fluorescentes sin un cambio de temperatura reflejan diferencias en el rendimiento de amplicones y no indican una mutación [37]. Se utilizó la prueba t de Student & # x02019s para establecer la significación estadística de la diferencia en las firmas fluorescentes a temperaturas específicas que distinguían mezclas artificiales de 5% de genomas mutantes, 95% de genomas normales de muestras con 100% de ADN normal.

Las mezclas artificiales que contienen diferentes proporciones de genomas normales y mutantes generan firmas fluorescentes que distinguen tan solo un 5% de genomas mutantes en un 95% de ADN normal. Todas las muestras se procesaron en réplicas y se trazaron individualmente. Panel A: Mezclas de ADN normal y ADN de la línea celular NCI-H1975 que porta la mutación T790M. Panel B: Mezclas de ADN normal y ADN de la línea celular HCC4006 ADN genómico que lleva la deleción del exón 19 de 9 pares de bases & # x00394L747-E749. El recuadro negro indica el rango de temperaturas donde las firmas fluorescentes discriminaban más para las diversas mezclas de ADN. Los porcentajes en los paneles corresponden al porcentaje de genomas mutantes en cada mezcla. El conjunto de réplicas de firmas fluorescentes para cada mezcla está etiquetado con un color diferente. Las firmas fluorescentes superpuestas al 1% y al 0% en cada panel se etiquetaron en azul y negro, respectivamente. La diferencia máxima en las firmas fluorescentes entre las mezclas de mutantes al 5% y al 10% fue estadísticamente significativa (p & # x0003c0,002).


  1. 1. Ott JJ, Stevens GA, Groeger J, Wiersma ST. Epidemiología mundial de la infección por el virus de la hepatitis B: nuevas estimaciones de la seroprevalencia y endemicidad de HBsAg específicas por edad. Vacuna. 201230 (12): 2212–9. pmid: 22273662.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  2. 2. Doo EC, Ghany MG. Virología de la hepatitis B para médicos. Clin Liver Dis. 201014 (3): 397–408. Publicación electrónica 20/07/2010. pmid: 20638021.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  3. 3. Liang TJ, Block TM, McMahon BJ, Ghany MG, Urban S, Guo JT, et al. Terapias presentes y futuras de la hepatitis B: del descubrimiento a la cura. Hepatología. 201562 (6): 1893–908. pmid: 26239691 PubMed Central PMCID: PMC4681668.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  4. 4. Zhu Y, Yamamoto T, Cullen J, Saputelli J, Aldrich CE, Miller DS y col. Cinética de la pérdida de hepadnavirus del hígado durante la inhibición de la síntesis de ADN viral. J Virol. 200175 (1): 311–22. pmid: 11119601.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  5. 5. Newbold JE, Xin H, Tencza M, Sherman G, Dean J, Bowden S, et al. La forma dúplex covalentemente cerrada del genoma del hepadnavirus existe in situ como una población heterogénea de minicromosomas virales. J Virol. 199569 (6): 3350–7. Epub 1995/06/01. pmid: 7745682 PubMed Central PMCID: PMCPMC189047.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  6. 6. Seeger C, Mason WS. Biología molecular de la infección por el virus de la hepatitis B. Virología. 2015479–480: 672–86. pmid: 25759099 PubMed Central PMCID: PMC4424072.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  7. 7. Werle-Lapostolle B, Bowden S, Locarnini S, Wursthorn K, Petersen J, Lau G, et al. Persistencia de cccDNA durante la historia natural de la hepatitis B crónica y disminución durante la terapia con adefovir dipivoxil. Gastroenterología. 2004126 (7): 1750–8. pmid: 15188170.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  8. 8. Alter H, Block T, Brown N, Brownstein A, Brosgart C, Chang KM, et al. Una agenda de investigación para curar la infección crónica por el virus de la hepatitis B. Hepatología. 201867 (3): 1127–31. pmid: 28877549 PubMed Central PMCID: PMCPMC5873273.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  9. 9. Tang L, Zhao Q, Wu S, Cheng J, Chang J, Guo JT. El estado actual y las direcciones futuras del descubrimiento de fármacos antivirales contra la hepatitis B. Opinión de expertos sobre el descubrimiento de fármacos. 201712 (1): 5–15. pmid: 27797587.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  10. 10. Chang J, Guo F, Zhao X, Guo JT. Estrategias terapéuticas para una cura funcional de la infección crónica por el virus de la hepatitis B. Acta pharmaceutica Sinica B. 20144 (4): 248–57. pmid: 26579392 PubMed Central PMCID: PMC4629125.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  11. 11. Nassal M. HBV cccDNA: reservorio de persistencia viral y obstáculo clave para la curación de la hepatitis B crónica. 201564 (12): 1972–84. pmid: 26048673.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  12. 12. Mason WS, Halpern MS, Inglaterra JM, Seal G, Egan J, Coates L, et al. Transmisión experimental del virus de la hepatitis B del pato. Virología. 1983131 (2): 375–84. Epub 1983/12/01. pmid: 6659368.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  13. 13. Tuttleman JS, Pourcel C, Summers J. Formación del conjunto de ADN viral circular cerrado covalentemente en células infectadas con hepadnavirus. Celda. 198647 (3): 451–60. Publicación electrónica 07/11/1986. pmid: 3768961.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  14. 14. Wu TT, Coates L, Aldrich CE, Summers J, Mason WS. En los hepatocitos infectados con el virus de la hepatitis B del pato, la plantilla para la síntesis de ARN viral se amplifica mediante una vía intracelular. Virología. 1990175 (1): 255–61. pmid: 2155510
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  15. 15. Guo JT, Guo H. Metabolismo y función del cccDNA del virus de la hepatitis B: implicaciones para el desarrollo de terapias antivirales dirigidas al cccDNA. Antiviral Res. 2015122: 91–100. pmid: 26272257 PubMed Central PMCID: PMC4586118.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  16. 16. Koniger C, Wingert I, Marsmann M, Rosler C, Beck J, Nassal M. Participación de la enzima de reparación del ADN del huésped TDP2 en la formación del reservorio de persistencia de ADN circular cerrado covalentemente de los virus de la hepatitis B. Proc Natl Acad Sci U S A. 2014111 (40): E4244–53. Publicación electrónica 10/09/2014. pmid: 25201958 PubMed Central PMCID: PMCPMC4209993.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  17. 17. Kitamura K, Que L, Shimadu M, Koura M, Ishihara Y, Wakae K, et al. La endonucleasa flap 1 está involucrada en la formación de cccDNA en el virus de la hepatitis B. PLoS Pathog. 201814 (6): e1007124. pmid: 29928064.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  18. 18. Long Q, Yan R, Hu J, Cai D, Mitra B, Kim ES, et al. El papel de las ADN ligasas del huésped en la formación de ADN circular cerrado covalentemente por hepadnavirus. PLoS Pathog. 201713 (12): e1006784. pmid: 29287110 PubMed Central PMCID: PMCPMC5747486.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  19. 19. Sohn JA, Litwin S, Seeger C. Mecanismo para la síntesis de ADN CCC en hepadnavirus. Más uno. 20094 (11): e8093. Publicación electrónica 04/12/2009. pmid: 19956651.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  20. 20. Qi Y, Gao Z, Xu G, Peng B, Liu C, Yan H y col. La ADN polimerasa kappa es un factor celular clave para la formación de ADN circular cerrado covalentemente del virus de la hepatitis B. PLoS Pathog. 201612 (10): e1005893. pmid: 27783675 PubMed Central PMCID: PMC5081172.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  21. 21. Ko C, Chakraborty A, Chou WM, Hasreiter J, Wettengel JM, Stadler D, et al. El reciclaje del genoma del virus de la hepatitis B y los eventos de infección secundaria de novo mantienen niveles estables de cccDNA. J Hepatol. 201869 (6): 1231–41. Epub 2018/08/25. pmid: 30142426.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  22. 22. Dezhbord M, Lee S, Kim W, Seong BL, Ryu WS. Caracterización de los eventos moleculares de la síntesis de ADN circular covalentemente cerrado en la infección de novo por el virus de la hepatitis B de células de hepatoma humano. Antiviral Res. 2019163: 11–8. pmid: 30639437.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  23. 23. Guo F, Zhao Q, Sheraz M, Cheng J, Qi Y, Su Q, et al. Los moduladores alostéricos de la proteína del núcleo del VHB alteran diferencialmente la biosíntesis de cccDNA a partir de la infección de novo y las vías de amplificación intracelular. PLoS Pathog. 201713 (9): e1006658. pmid: 28945802.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  24. 24. Wright GE, Hubscher U, Khan NN, Focher F, Verri A. Análisis del inhibidor de las ADN polimerasas alfa, delta y épsilon del timo de ternera. FEBS Lett. 1994341 (1): 128-30. Epub 1994/03/14. pmid: 8137912.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  25. 25. Gripon P, Cannie I, Urban S. Inhibición eficiente de la infección por el virus de la hepatitis B por péptidos acilados derivados de la proteína de gran superficie viral. J Virol. 200579 (3): 1613–22. pmid: 15650187.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  26. 26. Guo H, Jiang D, Zhou T, Cuconati A, Block TM, Guo JT. Caracterización del ADN circular relajado desproteinizado intracelular del virus de la hepatitis B: un intermedio de la formación de ADN circular covalentemente cerrado. J Virol. 200781 (22): 12472–84. Publicación electrónica 2007/09/07. JVI.01123-07 [pii] pmid: 17804499.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  27. 27. Gao W, Hu J. Formación de ADN circular covalentemente cerrado del virus de la hepatitis B: eliminación de la proteína ligada al genoma. J Virol. 200781 (12): 6164–74. Publicación electrónica 06/04/2007. pmid: 17409153 PubMed Central PMCID: PMCPMC1900077.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  28. 28. Ladner SK, Otto MJ, Barker CS, Zaifert K, Wang GH, Guo JT, et al. Expresión inducible del virus de la hepatitis B humana (VHB) en células de hepatoblastoma transfectadas de forma estable: un sistema novedoso para detectar posibles inhibidores de la replicación del VHB. Agentes antimicrobianos Chemother. 199741 (8): 1715–20. pmid: 9257747
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  29. 29. Sheraz M, Cheng J, Tang L, Chang J, Guo JT. Las topoisomerasas de ADN celular son necesarias para la síntesis de ADN circular cerrado covalentemente del virus de la hepatitis B. J Virol. 2019. pmid: 30867306.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  30. 30. Mejlvang J, Feng Y, Alabert C, Neelsen KJ, Jasencakova Z, Zhao X, et al. El nuevo suministro de histonas regula la velocidad de la horquilla de replicación y la descarga de PCNA. J Cell Biol. 2014204 (1): 29–43. Publicación electrónica 01/01/2014. pmid: 24379417 PubMed Central PMCID: PMCPMC3882791.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  31. 31. Lujan SA, Williams JS, Kunkel TA. Las ADN polimerasas dividen el trabajo de replicación del genoma. Trends Cell Biol. 201626 (9): 640–54. Publicación electrónica 06/06/2016. pmid: 27262731 PubMed Central PMCID: PMCPMC4993630.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  32. 32. Lehman IR, Kaguni LS. ADN polimerasa alfa. J Biol Chem. 1989264 (8): 4265–8. Epub 1989/03/15. pmid: 2647732.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  33. 33. Han T, Goralski M, Capota E, Padrick SB, Kim J, Xie Y, et al. La toxina antitumoral CD437 es un inhibidor directo de la ADN polimerasa alfa. Nat Chem Biol. 201612 (7): 511–5. Publicación electrónica 18/05/2016. pmid: 27182663 PubMed Central PMCID: PMCPMC4912453.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  34. 34. Starokadomskyy P, Gemelli T, Rios JJ, Xing C, Wang RC, Li H, et al. La ADN polimerasa alfa regula la activación de los interferones de tipo I a través de la síntesis citosólica de ARN: ADN. Nat Immunol. 201617 (5): 495–504. Epub 2016/03/29. pmid: 27019227 PubMed Central PMCID: PMCPMC4836962.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  35. 35. Ikegami S, Taguchi T, Ohashi M, Oguro M, Nagano H, Mano Y. La afidicolina previene la división de células mitóticas al interferir con la actividad de la ADN polimerasa alfa. Naturaleza. 1978275 (5679): 458–60. Epub 1978/10/05. pmid: 692726.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  36. 36. Hendzel MJ, Wei Y, Mancini MA, Van Hooser A, Ranalli T, Brinkley BR, et al. La fosforilación específica de la mitosis de la histona H3 se inicia principalmente dentro de la heterocromatina pericentromérica durante G2 y se propaga de forma ordenada coincidiendo con la condensación del cromosoma mitótico. Cromosoma. 1997106 (6): 348–60. pmid: 9362543.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  37. 37. Guo H, Mao R, Block TM, Guo JT. Producción y función del ADN circular relajado citoplasmático desproteinizado de hepadnavirus. J Virol. 201084 (1): 387–96. Publicación electrónica 30/10/2009. JVI.01921-09 [pii] pmid: 19864387 PubMed Central PMCID: PMC2798433.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  38. 38. Luo J, Cui X, Gao L, Hu J. Identificación de intermedio en la formación de ADN CCC del virus de la hepatitis B y detección de ADN CCC sensible y selectiva. J Virol. 2017. pmid: 28637752 PubMed Central PMCID: PMCPMC5553186.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  39. 39. Mitra B, Thapa RJ, Guo H, Block TM. Funciones del huésped utilizadas por el virus de la hepatitis B para completar su ciclo de vida: implicaciones para el desarrollo de agentes dirigidos al huésped para tratar la hepatitis B crónica. Antiviral Res. 2018158: 185–98. Epub 2018/08/27. pmid: 30145242 PubMed Central PMCID: PMCPMC6193490.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  40. 40. Newbold JE, Xin H, Tencza M, Sherman G, Dean J, Bowden S, et al. La forma dúplex covalentemente cerrada del genoma del hepadnavirus existe in situ como una población heterogénea de minicromosomas virales. Revista de Virología. 199569 (6): 3350–7. pmid: 7745682
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  41. 41. Liu F, Campagna M, Qi Y, Zhao X, Guo F, Xu C, et al. El alfa-interferón suprime la transcripción del hepadnavirus al alterar la modificación epigenética de los minicromosomas de cccDNA. PLoS Pathog. 20139 (9): e1003613. pmid: 24068929 PubMed Central PMCID: PMC3771898.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  42. 42. Avgousti DC, Della Fera AN, Otter CJ, Herrmann C, Pancholi NJ, Weitzman MD. La proteína VII del núcleo del adenovirus regula negativamente la respuesta al daño del ADN en el genoma del huésped. J Virol. 2017. Publicación electrónica 11/08/2017. pmid: 28794020 PubMed Central PMCID: PMCPMC5625504.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  43. 43. Lilley CE, Chaurushiya MS, Boutell C, Everett RD, Weitzman MD. La defensa antiviral intrínseca contra los genomas entrantes del HSV-1 incluye proteínas de reparación de ADN específicas y es contrarrestada por la proteína viral ICP0. PLoS Pathog. 20117 (6): e1002084. Epub 2011/06/24. pmid: 21698222 PubMed Central PMCID: PMCPMC3116817.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  44. 44. Hu J, Cheng J, Tang L, Hu Z, Luo Y, Li Y, et al. Base virológica para la curación de la hepatitis B crónica. Enfermedades infecciosas por SCA. 2018. pmid: 29893548.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  45. 45. Achuthan V, Perreira JM, Sowd GA, Puray-Chavez M, McDougall WM, Paulucci-Holthauzen A, et al. La interacción Capsid-CPSF6 otorga licencias para el tráfico nuclear de VIH-1 a sitios de integración del ADN viral. Microbio huésped celular. 201824 (3): 392–404 e8. Publicación electrónica 04/09/2018. pmid: 30173955.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  46. 46. ​​Warburton A, Redmond CJ, Dooley KE, Fu H, Gillison ML, Akagi K, et al. La integración del VPH secuestra y multimeriza un potenciador celular para generar un superpotenciador celular viral que impulsa una alta expresión de oncogén viral. PLoS Genet. 201814 (1): e1007179. pmid: 29364907 PubMed Central PMCID: PMC5798845.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  47. 47. Redmond CJ, Fu H, Aladjem MI, McBride AA. Integración del virus del papiloma humano: análisis por peinado molecular y fibra-FISH. Protocolos actuales en microbiología. 201851 (1): e61.pmid: 30129235 PubMed Central PMCID: PMC6209533.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  48. 48. Lucifora J, Arzberger S, Durantel D, Belloni L, Strubin M, Levrero M, et al. La proteína X del virus de la hepatitis B es esencial para iniciar y mantener la replicación del virus después de la infección. J Hepatol. 201155 (5): 996–1003. pmid: 21376091.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  49. 49. Wang GZ, Wang Y, Goff SP. Las histonas se cargan rápidamente en los ADN retrovirales no integrados poco después de la entrada nuclear. Microbio huésped celular. 201620 (6): 798–809. Epub 2016/11/22. pmid: 27866901 PubMed Central PMCID: PMCPMC5159289.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  50. 50. Zhu Y, Wang GZ, Cingoz O, Goff SP. NP220 media el silenciamiento del ADN retroviral no integrado. Naturaleza. 2018. Epub 2018/11/30. pmid: 30487602.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  51. 51. Schreiner S, Nassal M. ¿Un papel para la respuesta al daño del ADN del hospedador en la formación del ADNccc del virus de la hepatitis B y más allá? Virus. 20179 (5). pmid: 28531167 PubMed Central PMCID: PMCPMC5454437.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  52. 52. Mailand N, Bekker-Jensen S, Faustrup H, Melander F, Bartek J, Lukas C, et al. El RNF8 ubiquitila las histonas en las roturas de la doble hebra del ADN y promueve el ensamblaje de proteínas reparadoras. Celda. 2007131 (5): 887–900. Epub 2007/11/16. pmid: 18001824.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  53. 53. Tsukuda T, Fleming AB, Nickoloff JA, Osley MA. Remodelación de cromatina en un sitio de rotura de doble cadena de ADN en Saccharomyces cerevisiae. Naturaleza. 2005438 (7066): 379–83. Epub 2005/11/18. pmid: 16292314 PubMed Central PMCID: PMCPMC1388271.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  54. 54. van Attikum H, Fritsch O, Hohn B, Gasser SM. El reclutamiento del complejo INO80 por fosforilación de H2A vincula la remodelación de la cromatina dependiente de ATP con la reparación de la rotura de la doble hebra del ADN. Celda. 2004119 (6): 777–88. Epub 2004/12/21. pmid: 15607975.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  55. 55. Williamson EA, Wray JW, Bansal P, Hromas R. Descripción general de los códigos de histonas para la reparación del ADN. Prog Mol Biol Transl Sci. 2012110: 207–27. Publicación electrónica 04/07/2012. pmid: 22749147 PubMed Central PMCID: PMCPMC4039077.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  56. 56. Evrin C, Maman JD, Diamante A, Pellegrini L, Labib K. La unión de histona H2A-H2B por Pol alfa en el replisoma eucariota contribuye al mantenimiento de la cromatina represiva. EMBO J. 201837 (19). Publicación electrónica 2018/08/15. pmid: 30104407 PubMed Central PMCID: PMCPMC6166128.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  57. 57. Loeb DD, Tian R. Las mutaciones que aumentan el cebado in situ también disminuyen la circularización del virus de la hepatitis B del pato. J Virol. 200175 (14): 6492–7. pmid: 11413316.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  58. 58. Guo H, Xu C, Zhou T, Block TM, Guo JT. Caracterización de los factores del hospedador necesarios para la formación de ADN circular covalentemente cerrado (ccc) de hepadnavirus. Más uno. 20127 (8): e43270. Epub 2012/08/23. PONE-D-12-14952 [pii]. pmid: 22912842 PubMed Central PMCID: PMC3418247.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  59. 59. Yang W, Mason WS, Summers J. ADN viral circular cerrado covalentemente formado a partir de dos tipos de ADN lineal en hígado infectado por el virus de la hepatitis de la marmota. J Virol. 199670 (7): 4567–75. pmid: 8676483
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  60. 60. Yang W, Summers J. Replicación ilegítima del ADN de hepadnavirus lineal mediante recombinación no homóloga. J Virol. 199569 (7): 4029–36. pmid: 7769660.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  61. 61. Pospiech H, Rytkonen AK, Syvaoja JE. El papel de la actividad de la ADN polimerasa en la unión de extremos no homólogos humanos. Ácidos nucleicos Res. 200129 (15): 3277–88. Epub 2001/07/27. pmid: 11470886 PubMed Central PMCID: PMCPMC55831.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  62. 62. Johnson RE, Klassen R, Prakash L, Prakash S. Un papel principal de la ADN polimerasa delta en la replicación de las hebras de ADN principales y rezagadas. Mol Cell. 201559 (2): 163–75. Publicación electrónica 07/07/2015. pmid: 26145172 PubMed Central PMCID: PMCPMC4517859.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  63. 63. Mirman Z, Lottersberger F, Takai H, Kibe T, Gong Y, Takai K y otros. 53BP1-RIF1-shieldin contrarresta la resección de DSB mediante relleno dependiente de CST y Polalpha. Naturaleza. 2018560 (7716): 112–6. Publicación electrónica 20/07/2018. pmid: 30022158 PubMed Central PMCID: PMCPMC6072559.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  64. 64. Sells MA, Chen M, Acs G. Producción de partículas del virus de la hepatitis B en células hepG2 transfectadas con ADN del virus de la hepatitis B clonado. Proc Natl Acad Sci USA. 198784: 1005–9. pmid: 3029758
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  65. 65. Cui X, Guo JT, Hu J. Formación de ADN circular covalentemente cerrada del virus de la hepatitis B en hepatocitos de ratón inmortalizados asociados con la desestabilización de la nucleocápside. J Virol. 201589 (17): 9021–8. pmid: 26085156 PubMed Central PMCID: PMCPMC4524059.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  66. 66. Raney AK, Eggers CM, Kline EF, Guidotti LG, Pontoglio M, Yaniv M, et al. ADN genómico viral circular covalentemente cerrado nuclear en el hígado de ratones transgénicos del virus de la hepatitis B nulo alfa del factor nuclear 1 de hepatocitos. J Virol. 200175 (6): 2900–11. pmid: 11222715.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  67. 67. Lempp FA, Qu B, Wang YX, Urban S. Infección por el virus de la hepatitis B de una línea de células hepáticas de ratón reconstituida con polipéptido cotransportador de taurocolato de sodio humano. J Virol. 201690 (9): 4827–31. pmid: 26865711 PubMed Central PMCID: PMCPMC4836309.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  68. 68. Ko C, Chakraborty A, Chou WM, Hasreiter J, Wettengel JM, Stadler D, et al. El reciclaje del genoma del virus de la hepatitis B y los eventos de infección secundaria de novo mantienen niveles estables de cccDNA. J Hepatol. 2018. pmid: 30142426.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  69. 69. Lucifora J, Xia Y, Reisinger F, Zhang K, Stadler D, Cheng X, et al. Degradación específica y no hepatotóxica del cccDNA del virus de la hepatitis B nuclear. Ciencias. 2014343 (6176): 1221–8. pmid: 24557838.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  70. 70. Guo F, Tang L, Shu S, Sehgal M, Sheraz M, Liu B y otros. La activación de STING en los hepatocitos suprime la replicación del virus de la hepatitis B. Agentes antimicrobianos Chemother. 201761 (10): e00771–17. pmid: 28717041.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico
  71. 71. Petersen J, Dandri M, Mier W, Lutgehetmann M, Volz T, von Weizsacker F, et al. Prevención de la infección por el virus de la hepatitis B in vivo mediante inhibidores de entrada derivados de la proteína de envoltura grande. Nat Biotechnol. 200826 (3): 335–41. Epub 2008/02/26. nbt1389 [pii] pmid: 18297057.
    • Ver artículo
    • PubMed / NCBI
    • Google Académico

Áreas temáticas

Para obtener más información sobre las áreas temáticas de PLOS, haga clic aquí.

Queremos sus comentarios. ¿Tienen sentido estas áreas temáticas para este artículo? Haga clic en el objetivo junto al área temática incorrecta y avísenos. ¡Gracias por tu ayuda!

Es el área temática "Pequeño ARN de interferencia" aplicable a este artículo? sí No

Es el área temática "Síntesis de ADN" aplicable a este artículo? sí No

Es el área temática "ADN polimerasa" aplicable a este artículo? sí No

Es el área temática "Reparación de ADN" aplicable a este artículo? sí No

Es el área temática "Extracción de ADN" aplicable a este artículo? sí No

Es el área temática "Southern blot" aplicable a este artículo? sí No

Es el área temática "Transfección" aplicable a este artículo? sí No

Es el área temática "Replicación del ADN" aplicable a este artículo? sí No


Ver el vídeo: Técnicas para el análisis del ADN (Agosto 2022).