Información

7.3C: Ciclo del ácido cítrico - Biología

7.3C: Ciclo del ácido cítrico - Biología



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

El ciclo del ácido cítrico es una serie de reacciones que produce dos moléculas de dióxido de carbono, una GTP / ATP y formas reducidas de NADH y FADH2.

Objetivos de aprendizaje

  • Enumere los pasos del ciclo de Krebs (o ácido cítrico)

Puntos clave

  • La molécula de cuatro carbonos, el oxalacetato, que inició el ciclo se regenera después de los ocho pasos del ciclo del ácido cítrico.
  • Los ocho pasos del ciclo del ácido cítrico son una serie de reacciones redox, deshidratación, hidratación y descarboxilación.
  • Cada turno del ciclo forma un GTP o ATP, así como tres moléculas de NADH y una molécula de FADH2, que se utilizarán en los siguientes pasos de la respiración celular para producir ATP para la célula.

Términos clave

  • ciclo del ácido cítrico: una serie de reacciones químicas utilizadas por todos los organismos aeróbicos para generar energía a través de la oxidación de acetato derivado de carbohidratos, grasas y proteínas en dióxido de carbono.
  • ciclo de Krebs: una serie de reacciones enzimáticas que ocurren en todos los organismos aeróbicos; Implica el metabolismo oxidativo de las unidades de acetilo y sirve como la principal fuente de energía celular.
  • mitocondrias: en biología celular, una mitocondria (en plural mitocondrias) es un orgánulo encerrado en una membrana, a menudo descrito como "plantas de energía celular" porque generan la mayor parte del ATP

Ciclo del ácido cítrico (ciclo de Krebs)

Al igual que la conversión de piruvato en acetil CoA, el ciclo del ácido cítrico tiene lugar en la matriz de las mitocondrias. Casi todas las enzimas del ciclo del ácido cítrico son solubles, con la única excepción de la enzima succinato deshidrogenasa, que está incrustada en la membrana interna de la mitocondria. A diferencia de la glucólisis, el ciclo del ácido cítrico es un ciclo cerrado: la última parte de la vía regenera el compuesto utilizado en el primer paso. Los ocho pasos del ciclo son una serie de reacciones redox, deshidratación, hidratación y descarboxilación que producen dos moléculas de dióxido de carbono, una GTP / ATP y formas reducidas de NADH y FADH2. Esto se considera una vía aeróbica porque el NADH y FADH2 producidos deben transferir sus electrones a la siguiente vía del sistema, que utilizará oxígeno. Si esta transferencia no ocurre, tampoco ocurren los pasos de oxidación del ciclo del ácido cítrico. Tenga en cuenta que el ciclo del ácido cítrico produce muy poco ATP directamente y no consume oxígeno directamente.

Pasos en el ciclo del ácido cítrico

Paso 1. El primer paso es un paso de condensación, combinando el grupo acetilo de dos carbonos (de acetil CoA) con una molécula de oxalacetato de cuatro carbonos para formar una molécula de citrato de seis carbonos. CoA se une a un grupo sulfhidrilo (-SH) y se difunde para finalmente combinarse con otro grupo acetilo. Este paso es irreversible porque es muy exergónico. La velocidad de esta reacción se controla mediante la retroalimentación negativa y la cantidad de ATP disponible. Si los niveles de ATP aumentan, la velocidad de esta reacción disminuye. Si hay escasez de ATP, la tasa aumenta.

Paso 2. El citrato pierde una molécula de agua y gana otra a medida que el citrato se convierte en su isómero, isocitrato.

Pasos 3 y 4. En el paso tres, el isocitrato se oxida, produciendo una molécula de cinco carbonos, α-cetoglutarato, junto con una molécula de CO2y dos electrones, que reducen NAD + a NADH. Este paso también está regulado por la retroalimentación negativa de ATP y NADH y por un efecto positivo de ADP. Los pasos tres y cuatro son pasos de oxidación y descarboxilación, que liberan electrones que reducen el NAD+ a NADH y liberan grupos carboxilo que forman CO2 moléculas. El α-cetoglutarato es el producto del paso tres y un grupo succinilo es el producto del paso cuatro. CoA se une al grupo succinilo para formar succinil CoA. La enzima que cataliza el paso cuatro está regulada por la inhibición por retroalimentación de ATP, succinil CoA y NADH.

Paso 5. Se sustituye la coenzima A por un grupo fosfato y se forma un enlace de alta energía. Esta energía se utiliza en la fosforilación a nivel de sustrato (durante la conversión del grupo succinilo en succinato) para formar trifosfato de guanina (GTP) o ATP. Hay dos formas de la enzima, llamadas isoenzimas, para este paso, según el tipo de tejido animal en el que se encuentran. Una forma se encuentra en los tejidos que utilizan grandes cantidades de ATP, como el corazón y el músculo esquelético. Esta forma produce ATP. La segunda forma de la enzima se encuentra en tejidos que tienen una gran cantidad de vías anabólicas, como el hígado. Este formulario produce GTP. GTP es energéticamente equivalente a ATP; sin embargo, su uso está más restringido. En particular, la síntesis de proteínas utiliza principalmente GTP.

Paso 6. El paso seis es un proceso de deshidratación que convierte el succinato en fumarato. Dos átomos de hidrógeno se transfieren a FAD, produciendo FADH2. La energía contenida en los electrones de estos átomos es insuficiente para reducir NAD+ pero adecuado para reducir FAD. A diferencia del NADH, este portador permanece unido a la enzima y transfiere los electrones a la cadena de transporte de electrones directamente. Este proceso es posible gracias a la localización de la enzima que cataliza este paso dentro de la membrana interna de la mitocondria.

Paso 7. Se añade agua al fumarato durante el paso siete y se produce malato. El último paso del ciclo del ácido cítrico regenera el oxalacetato oxidando el malato. Se produce otra molécula de NADH.

Productos del ciclo del ácido cítrico

Dos átomos de carbono entran en el ciclo del ácido cítrico de cada grupo acetilo, lo que representa cuatro de los seis carbonos de una molécula de glucosa. Se liberan dos moléculas de dióxido de carbono en cada vuelta del ciclo; sin embargo, estos no contienen necesariamente los átomos de carbono añadidos más recientemente. Los dos átomos de carbono de acetilo eventualmente se liberarán en vueltas posteriores del ciclo; por tanto, los seis átomos de carbono de la molécula de glucosa original se incorporan eventualmente al dióxido de carbono. Cada turno del ciclo forma tres moléculas de NADH y una FADH2 molécula. Estos portadores se conectarán con la última parte de la respiración aeróbica para producir moléculas de ATP. También se fabrica un GTP o ATP en cada ciclo. Varios de los compuestos intermedios en el ciclo del ácido cítrico pueden usarse para sintetizar aminoácidos no esenciales; por lo tanto, el ciclo es anfibólico (tanto catabólico como anabólico).


7.3B: Metabolismo de macronutrientes adiposos

  • Contribuido por Brian Lindshield
  • Profesor asociado (Departamento de Alimentos, Nutrición, Dietética y Salud) de la Universidad Estatal de Kansas

Probablemente no le sorprenda que la función principal del tejido adiposo sea almacenar energía en forma de triglicéridos. En comparación con los tejidos extrahepáticos en su conjunto, en el tejido adiposo las siguientes vías no se realizan o no son importantes:

  • Síntesis y degradación de glucógeno
  • Síntesis de lactato
  • Desglose del cuerpo cetónico
  • Desglose de ácidos grasos
  • Síntesis y degradación de proteínas
  • Ciclo del ácido cítrico (no mucho ya que no es un tejido activo que necesite energía)

Estas vías están tachadas en la figura siguiente.

Figura 7.321 Se tachan las vías metabólicas que no se realizan o son importantes en el tejido adiposo, en comparación con los tejidos extrahepáticos en su conjunto 1

Al eliminar esas vías, nos quedan las capacidades metabólicas que se enumeran a continuación y se muestran en la siguiente figura:

Síntesis y degradación de triglicéridos

Figura 7.322 Capacidad metabólica adiposa

La síntesis de ácidos grasos solo se produce en el tejido adiposo y el hígado. En el tejido adiposo, los ácidos grasos se sintetizan y la mayoría se esterificará en triglicéridos para ser almacenados. En el hígado, algunos ácidos grasos se esterificarán en triglicéridos para ser almacenados, pero la mayoría de los triglicéridos se incorporarán a VLDL para que otros tejidos puedan usarlos o almacenarlos.


Ciclo del ácido cítrico y fosforilación oxidativa

El ciclo del ácido cítrico es una serie de reacciones químicas que eliminan electrones de alta energía y los utilizan en la cadena de transporte de electrones para generar ATP. Se produce una molécula de ATP (o un equivalente) por cada turno del ciclo.

La cadena de transporte de electrones es la parte de la respiración aeróbica que utiliza oxígeno libre como aceptor final de electrones para los electrones extraídos de los compuestos intermedios en el catabolismo de la glucosa. Los electrones pasan a través de una serie de reacciones químicas, con una pequeña cantidad de energía libre utilizada en tres puntos para transportar iones de hidrógeno a través de la membrana. Esto contribuye al gradiente utilizado en la quimiosmosis. A medida que los electrones pasan del NADH o descienden por la cadena de transporte de electrones, pierden energía. Los productos de la cadena de transporte de electrones son agua y ATP. Varios compuestos intermedios se pueden desviar hacia el anabolismo de otras moléculas bioquímicas, como ácidos nucleicos, aminoácidos no esenciales, azúcares y lípidos. Estas mismas moléculas, excepto los ácidos nucleicos, pueden servir como fuentes de energía para la vía de la glucosa.


Capítulo 4 Ácidos carboxílicos como biorreguladores y promotores del crecimiento intestinal en no rumiantes

El capítulo analiza los ácidos carboxílicos como biorreguladores y promotores del crecimiento intestinal en no rumiantes. El capítulo presenta una revisión de la literatura actual que relaciona los modos de acción y la eficacia de los ácidos carboxílicos de cadena corta y media en relación con la salud intestinal y el rendimiento de los animales no rumiantes, con énfasis en los cerdos. Durante los últimos 50 años, se han realizado numerosos estudios en todo el mundo para evaluar cuatro beneficios principales debido a los ácidos carboxílicos: (1) mejor salud y resistencia a las enfermedades, (2) crecimiento más rápido, (3) mayor eficiencia en la utilización de la dieta, (4) mejor calidad de la canal. Los efectos secundarios relacionados con la contaminación ambiental (menos N total, amoníaco volatilizado, P) y / o la reducción de los costos de producción también han recibido una atención considerable. El capítulo analiza la bioactividad intraluminal y postabsorbente de los ácidos grasos de cadena corta (AGCC) y los ácidos grasos de cadena media (AGCM) en no rumiantes, y particularmente en cerdos. El capítulo analiza: (1) algunos aspectos esenciales sobre las propiedades fisicoquímicas de los AGCC y los AGCM, (2) las tasas y concentraciones de producción intraluminal en secciones particulares del intestino, (3) los efectos directos y / o indirectos de los AGCC y los AGCM sobre la funcionalidad intestinal, (4) transporte transepitelial y mecanismos de absorción de los AGCC, y (5) funciones posteriores a la absorción en los procesos metabólicos y reguladores del cuerpo.


La presión en un cilindro que contiene nitrógeno disminuye continuamente a medida que se libera gas. Pero la presión en un cilindro que contiene propano mantiene una presión constante a medida que se libera propano. Por tanto, debe explicarse la diferencia de comportamiento. Introducción al concepto: Ley de los gases: La ley de los gases establece que la relación entre presión, volumen y temperatura. Esta ley es una combinación de la ley de Boyle y la ley de Charles. Ley de Boyle (ley de presión-volumen): esta ley establece que el volumen de una determinada cantidad de gas retenido a temperatura constante diverge inversamente con la presión funcional cuando la temperatura y la masa son constantes. Vα 1 P Ley de Charles (ley de temperatura-volumen): esta ley establece que el volumen de una determinada cantidad de gas retenido a presión constante es directamente proporcional a la temperatura. VαT

La presión en un cilindro que contiene nitrógeno disminuye continuamente a medida que se libera gas. & # x00A0Pero la presión en un cilindro que contiene propano mantiene una presión constante a medida que se libera propano. & # x00A0Por tanto, se explica la diferencia de comportamiento.

Introducción al concepto:

Ley de los gases: La ley de los gases establece que la relación entre presión, volumen y temperatura. Esta ley es una combinación de la ley de Boyle & # x2019 y la ley de Charles & # x2019.

    Ley de Boyle & # x2019s (ley de presión-volumen): Esta ley establece que el volumen de una determinada cantidad de gas retenido a temperatura constante diverge inversamente con la presión funcional cuando la temperatura y la masa son constantes.


1. Introducción

La germinación es una etapa compleja de la ontogénesis de la planta que implica el inicio del crecimiento, pero que no comprende los procesos finales de crecimiento y maduración [1, 2]. La esencia de la germinación es restaurar el metabolismo de las semillas inactivas que no muestran ninguna actividad fisiológica. El proceso activa el embrión de la semilla y permite el crecimiento de las plántulas [3, 4, 5]. Los brotes de siete o diez días son de tamaño apropiado para la cosecha, lo que permite su manipulación y comercialización poscosecha. El material muestra un mayor contenido de fitoquímicos que otras verduras [2].

Los microvegetales son plantas inmaduras producidas a partir de semillas de vegetales, cereales o hierbas. Miden de 5 a 10 cm de largo y se componen de un tallo y cotiledones. Por lo general, se cosechan en la base de sus cotiledones, justo después de que emergen los cotiledones, pero antes de que se desarrollen las hojas verdaderas. Esto ocurre de 7 a 21 días después de la germinación, dependiendo de la especie [6,7,8,9,10]. El ciclo de vida de los microgreens es muy corto y se deterioran rápidamente después de la cosecha. Cuando se almacenan a temperatura ambiente, se pueden consumir de forma segura en 1 o 2 días [9]. A diferencia de los brotes, el término & # x0201cmicrogreens & # x0201d no es científico, sino que se utiliza con fines de marketing. Su producción comenzó a finales de la década de 1980 [6] y, en los últimos años, ha ido ganando popularidad constantemente debido al creciente interés por los alimentos funcionales [10].

Las semillas en germinación podrían contener de 2 a 10 veces más fitoquímicos en comparación con las plantas adultas comerciales. Este contenido depende de las condiciones ambientales del cultivo de la especie y del tiempo de germinación, almacenamiento y procesamiento [10]. Hasta ahora, los brotes han sido reconocidos con más frecuencia que los microvegetales como alimentos que promueven el bienestar y la salud, ampliamente recomendados por los dietistas debido a su alto contenido de nutrientes y compuestos bioactivos, como flavonoides, ácidos hidroxicinámicos, vitaminas y glucosinolatos, minerales y carotenoides [ 4,10]. Estos fitoquímicos parecen jugar un papel crucial en la protección del cuerpo humano contra diferentes tipos de trastornos crónicos como enfermedades cardiovasculares, diabetes y cáncer [10,11]. Además, las hojas germinadas y microverdes se caracterizan por un bajo poder calorífico (29 & # x02013128 kcal / 100 g) y un bajo índice glucémico [10,11].

La cantidad de especies que se pueden consumir como brotes o microvegetales es enorme. Sus semillas difieren en la tasa de germinación, el sabor y la composición química. Las semillas más populares utilizadas para la producción de brotes y microvegetales incluyen las de cereales, legumbres, semillas oleaginosas o crucíferas, por ejemplo, lentejas, soja, brócoli, alfalfa, rábano, girasol, berro, calabaza, frijol mungo o cebolla (cebollino) [1 ].

Hoy en día, en una sociedad más concienciada e interesada en estilos de vida saludables y prevención de enfermedades, los germinados y microvegetales parecen productos muy deseables. Además de ofrecer los beneficios para la salud mencionados, pueden producirse y utilizarse fácil y rápidamente de muchas formas diferentes. Sin embargo, los brotes y los microgreens todavía se consideran ingredientes culinarios innovadores. Se utilizan como complementos en sándwiches, ensaladas, sopas, postres y bebidas [4,10,12], y su popularidad se debe a su textura delicada, colores únicos y alta palatabilidad, lo que los hace útiles en la industria culinaria. El mercado japonés ofrece muchos tipos de productos alimenticios a base de brotes o microvegetales en forma de polvo o aditivos para alcoholes, jugos y tés [13]. También están disponibles todo el año, incluso en invierno, con la falta de frutas y hortalizas frescas [10].

Hoy en día, con el envejecimiento de la población que padece cada vez más de las principales enfermedades crónicas del siglo XXI, como la obesidad, las enfermedades cardiovasculares, el cáncer y la diabetes tipo 2, a menudo se recomienda una dieta rica en frutas y verduras como medida preventiva. Todas las organizaciones que se centran en la nutrición (es decir, la OMS, el USDA de EE. UU. O I & # x0017b & # x0017b de Polonia) afirman que las dietas ricas en frutas y verduras proporcionan abundantes compuestos de conocidos beneficios protectores contra las enfermedades crónicas. Estos compuestos incluyen polifenoles, vitaminas (es decir, ácido L-ascórbico o carotenoides como precursores de la provitamina A), aminoácidos o clorofilas. Por lo tanto, es crucial identificar los beneficios para la salud de los brotes y microvegetales comerciales que se consumen comúnmente en la primavera cuando las frutas, verduras y hierbas frescas están menos disponibles. Los estudios sobre la relación entre la composición química y la actividad biológica de los brotes y microvegetales son limitados, sin embargo, estos productos se ofrecen comúnmente en la venta diaria.

Por tanto, el objetivo de este trabajo fue caracterizar y comparar antioxidantes naturales (ácido L-ascórbico, compuestos fenólicos y carotenos) y su actividad biológica in vitro (capacidad antioxidante, actividad antidiabética, antiobesidad y anticolinesterasa) en brotes. y microvegetales para fomentar su aplicación como alimentos naturales y saludables. Un objetivo adicional fue caracterizar los valores nutricionales de los brotes y microvegetales en términos de su contenido de aminoácidos, pectinas, cenizas, azúcar, ácidos orgánicos y sólidos solubles. También determinamos su materia seca y pH. Algunos de los brotes y microvegetales seleccionados se investigaron por primera vez.


Determinación de la vía de síntesis de glucógeno mediante análisis de resonancia magnética nuclear de 13 C ☆

El nivel de glucógeno hepático sintetizado directamente a partir de glucosa se midió en ratas con glucosa [1-13C]. El espectro de resonancia magnética nuclear (RMN) de la glucosa se utilizó para medir la distribución de la etiqueta de 13 C de C1 a los otros carbonos. A ratas hembra Sprague-Dawley se les implantaron quirúrgicamente catéteres en la arteria carótida izquierda y la vena yugular derecha, seguido de un período de recuperación de 3 días y un ayuno de 24 horas para agotar el glucógeno hepático. Una infusión de 2 horas del animal en ayunas con [1 - 13 C] glucosa fue seguida inmediatamente por la extracción de sangre y tejido hepático. El hígado se dividió en los lóbulos derecho, izquierdo, caudado y medial, y luego se fijó por congelación en nitrógeno líquido y se almacenó a -80 ° C. Los espectros de glucosa de 13C NMR se obtuvieron a partir del glucógeno que se aisló de cada lóbulo del hígado y se hidrolizó a glucosa con amiloglucosidasa. Los espectros se obtuvieron a 50,3 MHz en un espectrómetro de RMN Gemini de 200 MHz de calibre estrecho (Varian, Palo Alto, CA). La distribución de 13 C en carbonos de glucosa se midió a partir de estos espectros, y se calculó que el porcentaje de ruta directa era 29% ± 2,5%. La variación metabólica para la síntesis de glucógeno en el hígado se determinó midiendo la contribución de la vía directa en cada uno de los cuatro lóbulos hepáticos. Los valores porcentuales de la vía directa fueron similares (PAG & gt .05) en los lóbulos derecho (35% ± 4,9%), izquierdo (26% ± 5,1%), medial (25% ± 4,9%) y caudado (27% ± 5,6%). Para algunos de los animales, la vía directa se determinó por infusión con glucosa [6 - 13 C]. Estos resultados luego se compararon con los resultados de C1glucosa marcada para medir la pérdida de C1 de la glucosa infundida como CO2 en la vía de las pentosas fosfato (PPP). El porcentaje de la ruta directa determinada a partir de la glucosa [1 - 13 C] en comparación con la glucosa [6 - 13 C] indica una actividad de PPP insignificante de la glucosa infundida. Finalmente, se encontró carbono etiquetado en C3 y C4, que indica un flujo de glucosa a través del ciclo del ácido cítrico (CAC).

Con el apoyo de la subvención núm. 1 R15 DK 41439-01 de los Institutos Nacionales de Salud y una subvención de investigación Sigma Xi.


Abstracto

Los productos a base de aminoácidos se han utilizado como fuentes alternativas de fertilizantes nitrogenados (N) para mejorar el rendimiento del césped, especialmente donde existe una fuerte dependencia de las fuentes de nitrógeno sintético. Sin embargo, los mecanismos fisiológicos subyacentes a las mejoras en el rendimiento del césped no están bien documentados. El objetivo de esta investigación fue determinar si las aplicaciones de un subproducto orgánico que contiene triptófano (TRP-B) o triptófano (TRP) + urea mejoran el bentgrass rastrero (Agrostis stolonifera L.) rendimiento en comparación con aplicaciones independientes de urea, una fuente de N sintético de uso común. En dos universidades separadas, se trasplantaron en macetas maduras bentgrass rastreras "A-4" en contenedores y se permitió que se restablecieran en cámaras de crecimiento antes de ser tratadas. Los tratamientos incluyeron TRP-B, urea y TRP + urea aplicados cada 14 días en tres dosis de N diferentes: 2,5, 12,25 y 24,5 kg N ha -1. Al final del ensayo, TRP-B y TRP + urea aumentaron el ácido indol-3-acético de la hoja (IAA) en un 227 y 255%, respectivamente, en relación con la urea a la tasa alta de N, según lo medido el día 42 del estudio. Las aplicaciones de TRP-B y TRP + urea también aumentaron la biomasa de las raíces en un 22 y 20%, respectivamente, en comparación con la urea solo en la tasa alta de N. Los tratamientos TRP-B y TRP + urea no afectaron los aminoácidos totales de la hoja o la eficiencia fotoquímica cuando se compararon con urea solamente. En general, los resultados indican que la aplicación de TRP-B o TRP + urea a 24.5 kg N ha -1 cada 2 semanas puede mejorar el contenido de IAA de las hojas y raíces, la biomasa de las raíces y la subsiguiente calidad del bentgrass rastrero en relación con las aplicaciones de urea solamente.

Abreviaturas

C reeping bentgrass (Agrostis stolonifera L.) es una especie de césped de estación fría que se usa comúnmente para superficies deportivas de alto valor y manejo intensivo. Como todos los pastos de estación fría, a medida que avanza la temporada de crecimiento, el bentgrass rastrero puede experimentar períodos de declive (Dernoeden, 2000). Los síntomas del declive del bentgrass durante la temporada de crecimiento incluyen muerte regresiva de las raíces, senescencia excesiva de las hojas y adelgazamiento del dosel del césped.

Se han utilizado productos que contienen aminoácidos para mejorar el crecimiento de las raíces del césped en la estación fría y mejorar la calidad del césped (Zhang et al., 2013). En los últimos años, se han desarrollado varios bioestimulantes y productos biofertilizantes para el mercado de céspedes especiales (Schmidt et al., 2003 Ervin y Zhang, 2008), algunos de los cuales contienen aminoácidos como ingredientes básicos (Ervin et al., 2004, 2009). . Los aminoácidos son componentes básicos de proteínas, enzimas, ácidos nucleicos, antioxidantes y otros compuestos secundarios (Taiz y Zeiger, 2010) y los tejidos vegetales los absorben y traslocan fácilmente (Joy y Antcliff, 1966 Mäkelä et al., 1996). La aplicación exógena de un producto a base de aminoácidos antes y durante los períodos de declive podría servir para estimular los aminoácidos endógenos y la posterior producción de importantes compuestos protectores del estrés como la prolina y los antioxidantes (Carbonera et al., 1989 Vidmar et al., 2000 Bhowmik et al., 2008).

El triptófano (TRP), un aminoácido, es un precursor principal en la biosíntesis del ácido fitohormonal indol-3-acético (IAA) o auxina. La auxina funciona como un regulador del crecimiento para aumentar el inicio de las raíces y retrasar la senescencia de las hojas (Zhang et al., 2013). Zhang y col. (2009) mostró que la aplicación de un fertilizante orgánico dosificado con TRP mejoró los niveles endógenos de IAA y citoquininas, aumentó la actividad de la enzima antioxidante de las hojas y mejoró el crecimiento de las raíces en festuca alta [Schenodorus arundinceus (Schreb.) Dumort.]. El triptófano puede actuar como un osmolito, un regulador del transporte de iones y un modulador de la apertura de los estomas (Rai, 2002). La aplicación de TRP puede mejorar el metabolismo del nitrógeno (N) y el contenido de clorofila, como lo demostraron Rao et al. (2012), donde las aplicaciones de L-triptófano al maíz (Zea mays L.) aumentó el contenido relativo de agua y clorofila de las hojas y redujo el daño de la membrana celular.

Un problema común al que se enfrentan los administradores de césped es el de mantener el crecimiento en una zona de raíces con base de arena. Las zonas de raíces a base de arena presentan un dilema único, donde la capacidad de intercambio catiónico (CIC) o la capacidad de retención de nutrientes es extremadamente baja y las tasas de infiltración y drenaje de agua son relativamente altas. En estas condiciones, los nutrientes aplicados al suelo tienen una alta probabilidad de lixiviación. Debido a esto, los administradores de césped a menudo utilizan lo que se conoce como alimentación con cuchara, donde se aplica una pequeña cantidad de fertilizante con mayor frecuencia en lugar de aplicar la cantidad requerida de una sola vez. La idea detrás de este método es que el césped está recibiendo una cantidad adecuada de fertilizante que mejorará el crecimiento, pero esa cantidad no es suficiente para provocar una pérdida significativa de nutrientes o contaminación (Howieson y Christians, 2001). La urea es una fuente de N sintético que se usa comúnmente en un programa de nutrientes de alimentación con cuchara debido a su alta solubilidad en agua y bajo precio (Howieson y Christians, 2001).

Los objetivos de este estudio fueron (i) determinar si las aplicaciones de un subproducto que contiene TRP (TRP-B) o TRP + urea mejoran el rendimiento del bentgrass rastrero en comparación con la urea sola en niveles equivalentes de N, y (ii) identificar un tasa de TRP-B que igualaría la tasa de alimentación con cuchara de urea que el superintendente de un campo de golf usaría en un green, tee o fairway rastrero de bentgrass.


Ruta en fase sólida a bloques de construcción de aminoácidos catiónicos protegidos con Fmoc

Los diaminoácidos se encuentran comúnmente en compuestos bioactivos, sin embargo, solo unos pocos están disponibles comercialmente como componentes básicos para la síntesis de péptidos en fase sólida. En el presente trabajo se desarrolló una ruta conveniente y económica hacia bloques de construcción de aminoácidos con carga múltiple con grado variable de hidrofobicidad. Un protocolo de fase sólida versátil que conduce a intermedios de aminoalcohol protegidos selectivamente fue seguido por oxidación para producir los bloques de construcción de aminoácidos di- o policatiónicos deseados en cantidades a escala de gramos. La secuencia sintética comprende la carga de (S)-1-(pag-nosil) aziridina-2-metanol en una resina de bromuro de tritilo recién preparada, seguida de apertura del anillo con una amina primaria apropiada, protección N β-Boc en la resina de la amina secundaria resultante, intercambio del grupo protector N α, escisión de la resina, y finalmente oxidación en solución para producir los bloques de construcción sustituidos con γ-aza objetivo que tienen un esquema de protección Fmoc / Boc. Esta estrategia facilita la incorporación de múltiples cargas positivas en los bloques de construcción siempre que estén disponibles las correspondientes di- o poliaminas parcialmente protegidas. Se preparó una serie de compuestos que cubren una amplia variedad de análogos sustituidos con γ-aza de aminoácidos neutros simples, así como análogos que presentan un alto volumen o cadenas laterales policatiónicas. Se incorporaron dos bloques de construcción en secuencias de péptidos usando síntesis de péptidos en fase sólida asistida por microondas, lo que confirma su utilidad general.

Esta es una vista previa del contenido de la suscripción, acceda a través de su institución.


4. Materiales y métodos

4.1 Procedimientos generales

Todos los productos químicos (grado reactivo) utilizados se adquirieron de Sigma & # x02013Aldrich (EE. UU.) Y Sinopharm Chemical Reagent Co. Ltd. (China). Los espectros de RMN de 1H se midieron en espectrómetros de RMN Varian Unity Inova de 300 o 400 MHz a 25 ° C y se referenciaron a TMS. Los desplazamientos químicos se informan en ppm utilizando la línea de disolvente residual como estándar interno. Los patrones de división se diseñan como s, singlete d, doblete t, triplete m, multiplete. Los espectros HRMS se adquirieron en un LC / MS Agilent Technologies 6220 Accurate-Mass TOF. Se realizó cromatografía analítica en capa fina (TLC) sobre las láminas de gel de sílice con respaldo de vidrio (gel de sílice 60 & # x000c5 GF254). Todos los compuestos se detectaron usando luz ultravioleta (254 o 365 nm). La HPLC analítica se realizó en SHIMADZU LC-20AD. Antes de KI En la medición, se determinó que todos los compuestos eran & # x0003e95% puros por HPLC en base al porcentaje de área de pico.

4.1.1. (R) Ácido -2-hidroxi-3,3-dimetilbutanoico (7)

A una solución de 6 (1,0 g, 7,62 mmol, 1,0 equiv.) En 0,5 M H2ASI QUE4 a 0 & # x000b0C se añadió una solución de NaNO2 (3,15 g, 45,6 mmol, 6,0 equiv.) En H2O (10 ml) gota a gota durante 30 min. Una vez completada la adición, la solución se calentó a 23 ° C y se agitó durante la noche (

16 h). La mezcla de reacción se diluyó con H2O (30 ml), se extrajo con éter dietílico (3 & # x000d7 30 ml) y las capas orgánicas combinadas se secaron (Na2ASI QUE4), y concentrado para permitir 7 (806 mg, 81%) como un aceite incoloro, que se utilizó directamente en la siguiente reacción. RMN 1H (400 MHz, CDCl3) & # x003b4 3.90 (s, 1H), 1.02 (s, 9H) MS (ESI & # x02013) calculado para C6H11O3 [M & # x02013H] & # x02013 131,1, encontrado 131,4.

4.1.2. (R)-2-(tert-Ácido butildimetilsilil) oxi-3,3-dimetilbutanoico (8)

A una solución de 7 (2,06 g, 15,6 mmol, 1,0 equiv.) En DMF (15 ml) se le añadió imidazol (5,09 g, 74,8 mmol, 4,8 equiv.) Y tert-butilclorodimetilsilano (5,64 g, 37,4 mmol, 2,4 equiv.). La mezcla se agitó durante la noche a 23ºC y después se extrajo con acetato de etilo y éter de petróleo 1: 1 (3ºC y 30 ml). La capa orgánica se lavó sucesivamente con una solución acuosa de ácido cítrico al 10%, H2O, NaHCO acuoso saturado3y salmuera, luego se seca (Na2ASI QUE4) y concentrado. El residuo se disolvió en metanol (100 ml), luego en una solución acuosa de K 0,8 M2CO3 se añadió una solución (50 ml). Después de 4 h, se añadió una solución acuosa de ácido cítrico al 10% para ajustar el pH a 4. La mezcla se extrajo con acetato de etilo (3 & # x000d7 30 ml) y las capas orgánicas combinadas se secaron (Na2ASI QUE4) y concentrado. El residuo se purificó mediante cromatografía ultrarrápida (éter de petróleo 10: 1 y acetato de etilo) para producir el compuesto del título (3,1 g, 81%) como un aceite incoloro: 1 H RMN (400 MHz, CDCl3) & # x003b4 9,64 (s ancho, 1 H), 3,83 (s, 1 H), 0,97 (s, 9 H), 0,93 (s, 9 H), 0,08 (s, 3 H), 0,06 (s, 3 H) RMN 13C ( 100 MHz, CDCl3) & # x003b4 176,6, 80,0, 35,4, 26,0, 25,8, 18,3, & # x022125,2 (2 C) MS (ESI & # x02013) calculado para C12H25O3Si [M & # x02013H] & # x02013 245,2, encontrado 245,2.

4.1.3. (R) -2,5-Dioxopirrolidin-1-il-2- (tert-butildimetilsilil) oxi-3,3-dimetilbutanoato (9)

A una solución de 8 (1,99 g, 8,1 mmol, 1,0 equiv.) En DME (50 ml) a 0 & # x000b0C, norte-hidroxisuccinimida (1,87 g, 16,2 mmol, 2,0 equiv.) y DCC (2,34 g, 11,3 mmol, 1,4 equiv.) y la mezcla se agitó durante la noche a 23ºC. La mezcla se filtró a través de un lecho corto de Celite lavando con acetato de etilo y el filtrado se concentró. El residuo se purificó mediante cromatografía ultrarrápida (1: 1 de éter de petróleo & # x02013CH2Cl2) para producir el compuesto del título (1,60 g, 60%) como un aceite incoloro: 1H RMN (400 MHz, CDCl3) & # x003b4 4.09 (s, 1H), 2.81 (s ancho, 4H), 1.05 (s, 9H), 0.92 (s, 9H), 0.12 (s, 3H), 0.09 (s, 3H) 13C NMR ( 100 MHz, CDCl3) & # x003b4 169.1, 168.1, 78.5, 36.0, 25.7 (3C), 18.2, & # x022125.2, & # x022125.5 MS (ESI & # x02013) calculado para C16H29NO5Si [M] & # x02013 343,2, encontrado 342,8.

4.1.4. 5 & ​​# x02032-O-[norte-((R) -2-hidroxi-3,3-dimetilbutanoil) sulfamoil] adenosina (1a)

A una solución de 10 Se añadió 25 (100 mg, 0,26 mmol, 1,0 equiv.) En DMF (1,0 ml). 9 (179 mg, 0,52 mmol, 2,0 equiv.) Y Cs2CO3 (169 mg, 0,52 mmol, 2,0 equiv.) A 23ºC. Después de agitar 24 horas a 23ºC, la solución se concentró al vacío. Purificación por cromatografía ultrarrápida (500: 6: 1,5 CH2Cl2& # x02013MeOH & # x02013Et3N) proporcionó 5 & # x02032-O-<norte-[(R)-2-(tert-butildimetilsilil) oxi-3,3-dimetilbutanoil] sulfamoilo> -2 & # x02032,3 & # x02032-O-sal de isopropilideneadenosina trietilamonio (72 mg) como un sólido amarillo. Este compuesto se disolvió en TFA acuoso al 80% (2 ml). Después de agitar 48 ha 8 ° C, la solución se concentró al vacío. Purificación por cromatografía ultrarrápida (10: 1 CH2Cl2& # x02013MeOH) proporcionó el compuesto del título (8 mg, 7% de rendimiento del compuesto 10) como un sólido blanco: 1 H NMR (400 MHz, CD3OD) y # x003b4 8.57 (s, 1H), 8.33 (s, 1H), 6.38 (s, 1H), 5.05 y # x020135.00 (m, 1H), 4.79 y # x020134.77 (m, 1H), 4.74 & # x020134.70 (m, 1H), 4.40 & # x020134.37 (m, 1H), 4.14 & # x020134.10 (m, 1H), 3.62 (s, 1H), 0.99 (s, 9H) 13 C NMR (100 MHz, CD3OD) & # x003b4 179,0, 158,7, 150,3, 140,9, 140,6, 121,2, 95,3, 85,2, 80,3, 77,2, 71,7, 59,7, 36,1, 26,5 HRMS (ESI & # x02013) calculado para C16H23norte6O8S [M & # x02013H] & # x02013 459.1304, encontrado 459.1310.

4.1.5. 2 & # x02032,3 & # x02032,5 & # x02032-O-tritert-Butildimetilsilil) vidarabina (12)

A una solución de vidarabina 11 (200 mg, 0,748 mmol, 1 equiv.) En DMF (1,5 ml) se añadieron imidazol (306 mg, 4,49 mmol, 6,0 equiv.) Y TBSCl (677 mg, 4,49 mmol, 6,0 equiv.) Y la reacción se agitó durante la noche a 23ºC. # x000b0C La mezcla de reacción se repartió entre EtOAc y H2O y la capa orgánica se secó (NaSO4) y concentrado. Purificación por cromatografía ultrarrápida (80: 1 CH2Cl2& # x02013MeOH) proporcionó el compuesto del título (319 mg, 70%) como un sólido blanco: 1H RMN (400 MHz, CDCl3) & # x003b4 8,36 (s, 1 H), 8,03 (s, 1 H), 6,48 (d, J = 3.6 Hz, 1H), 5.59 (s, 2H), 4.34 & # x020134.32 (m, 1H), 4.19 & # x020134.16 (m, 1H), 4.03 & # x020133.98 (m, 1H), 3.88 & # x020133.84 (m, 2H), 0.94 (s, 9H), 0.92 (s, 9H), 0.72 (s, 9H), 0.15 (s, 6H), 0.09 (s, 3H), 0.08 (s , 3H), 𢄠.08 (s, 3H), 𢄠.45 (s, 3H) 13 C NMR (75 MHz, CDCl3) δ 155.5, 153.0, 149.6, 140.8, 119.3, 86.5, 85.9, 78.3, 77.6, 63.0, 26.1, 25.9, 25.7, 18.5, 18.1, 17.9, 𢄤.4, 𢄥.2, 𢄥.5 MS (ESI+) calcd for C28H56norte5O4Si3[M+H] + 610.4, found 610.0.

4.1.6. 2′,3′-O-di(tert-Butyldimethylsilyl)vidarabine (13)

To a solution of 12 (50 mg, 0.082 mmol) in THF (0.5 mL) was added 35% aqueous TFA (2 mL). The reaction mixture was stirred for 2 h at 23 ଌ., then quenched with saturated aqueous NaHCO3 and extracted with EtOAc. The combined organic layers were dried (NaSO4) and concentrated. Purification by flash chromatography (80:1 CH2Cl2–MeOH) afforded the title compound (33 mg, 81%) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 8.30 (s, 1H), 8.05 (s, 1H), 6.44 (d, J = 4.0 Hz, 1H), 5.83 (s, 2H), 4.38𠄴.34 (m, 1H), 4.31𠄴.27 (m, 1H), 4.13 (s, 1H), 4.08𠄴.04 (m, 1H), 3.92𠄳.88 (m, 2H), 0.94 (s, 9H), 0.67 (s, 9H), 0.16 (s, 6H), 𢄠.06 (s, 3H), 𢄠.41 (s, 3H) 13 C NMR (75 MHz, CD3OD) δ 156.8, 153.6, 149.7, 141.9, 119.5, 88.0, 87.1, 79.1, 78.4, 62.6, 26.2, 26.0, 18.6, 18.3, 𢄤.2, 𢄤.4, 𢄤.8, 𢄥.4 MS (ESI+) calcd for C22H42norte5O4Si2 [M+H] + 496.3, found 496.0.

4.1.7. 2′,3′-O-di(tert-Butyldimethylsilyl)-5′-O-(sulfamoyl)vidarabine (14)

To a solution of 13 (100 mg, 0.2 mmol, 1.0 equiv) in 1,4-dioxane (5 mL) was added NaH (60% w/w in mineral oil, 60 mg, 1.5 mmol, 7.5 equiv). The reaction mixture was stirred for 1 h at 23 ଌ. Next, NH2ASI QUE2Cl 27 (58 mg, 0.5 mmol, 2.5 equiv) was added and the reaction was stirred for 24 h, then quenched by the slow addition of 5:1 CH2Cl2–MeOH (10 mL). The reaction mixture was filtered through silica gel and the filtrate was concentrated. Purification by flash chromatography (30:1 CH2Cl2–MeOH) afforded the title compound (70 mg, 60%) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 8.22 (s, 2H), 6.48 (d, J = 3.2 Hz, 1H), 4.48 (dd, J = 10.4, 7.2 Hz, 1H), 4.40𠄴.24 (m, 4H), 0.98 (s, 9H), 0.72 (s, 9H), 0.22 (s, 6H), 𢄠.02 (s, 3H), 𢄠.43 (s, 3H) 13 C NMR (75 MHz, DMSO-D6) δ 155.9, 152.7, 149.1, 139.8, 118.3, 84.2, 81.9, 77.3, 76.5, 68.1, 25.7, 25.4, 17.6, 17.3, 𢄤.6, 𢄤.7, 𢄥.4, 𢄥.8 MS (ESI+) calcd for C22H43norte6O6SSi2 [M+H] + 575.2, found 574.8.

4.1.8. 5′-O-[norte-((R)-2-Hydroxy-3,3-dimethylbutanoyl)sulfamoyl]vidarabine (2)

To a solution of 14 (420 mg, 0.70 mmol, 1.0 equiv) in DMF (10 mL) was added 9 (497 mg, 1.40 mmol, 2.0 equiv) and Cs2CO3 (476 mg, 1.40 mmol, 2.0 equiv). The reaction was stirred for 24 h then concentrated in vacuo. The residue was purified by flash chromatography (500:6:1.5 CH2Cl2–MeOH𠄾t3N) to afford 2′,3′-O-di(tert-butyldimethylsilyl)-5′-O-<norte-[(R)-2-(tert-butyldimethylsilyloxy)-3,3-dimethylbutanoyl]sul- famoyl>vidarabine triethylammonium salt (80 mg) as a yellow solid. This intermediate was dissolved in 80% aqueous TFA (2 mL). After stirring 60 h at 23 ଌ, the solution was concentrated in vacuo. Purification by flash chromatography (10:1 CH2Cl2–MeOH) afforded the title compound (10 mg, 3% yield from compound 14) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 8.58 (s, 1H), 8.19 (s, 1H), 6.38 (d, J = 5.2 Hz, 1H), 5.01 (d, J = 13.6 Hz, 1H), 4.74 (d, J = 2.4 Hz, 1H), 4.68 (dd, J = 16.0, 2.4 Hz, 1H), 4.52 (t, J = 5.2 Hz, 1H), 3.95 (t, J = 5.2 Hz, 1H), 3.64 (s, 1H), 1.00 (s, 9H) 13 C NMR (100 MHz, CD3OD) δ 179.6, 158.7, 150.1, 142.2, 141.5, 121.3, 91.8, 85.7, 81.3, 80.2, 76.9, 59.8, 36.2, 26.5 HRMS (ESI–) calcd for C16H23norte6O8S [M–H] – 459.1304, found 459.1318.

4.1.9. 3′,5′-O-di(tert-Butyldimethylsilyl)vidarabine (15)

To a solution of vidarabine 11 (2.0 g, 7.5 mmol, 1.0 equiv) in DMF (40 mL) were added triethylamine (5.2 mL, 37 mmol, 5.0 equiv) and TBSCl (2.82 g, 18.7 mmol, 2.5 equiv). The reaction mixture was stirred for 16 h at 23 ଌ then partitioned between EtOAc and H2O. The organic layer was dried (NaSO4), and concentrated. Purification by flash chromatography (80:1 CH2Cl2–MeOH) afforded the title compound (2.4 g, 65%) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 8.35 (s, 1H), 8.27 (s, 1H), 6.33 (d, J = 2.4 Hz, 1H), 5.65 (s, 2H), 4.88 (d, J = 10.0 Hz, 1H), 4.37𠄴.34 (m, 1H), 4.14 (d, J = 10.0 Hz, 1H), 4.07 (s, 1H), 3.96 (d, J = 11.2 Hz, 1H), 3.81 (d, J = 11.2 Hz, 1H), 0.93 (s, 9H), 0.93 (s, 9H), 0.15 (s, 6H), 0.14 (s, 6H) MS (ESI+) calcd for C22H42norte5O4Si2 [M+H] + 496.3, found 496.4.

4.1.10. 3′,5′-O-di(tert-Butyldimethylsilyl)-2′-deoxy-2′-fluoroadenosine (16)

To a solution of 15 (100 mg, 0.20 mmol, 1.0 equiv) and pyridine (0.20 mL, 10 mmol, 10 equiv) in CH2Cl2 (3 mL) at 23 ଌ was added diethylaminosulfur trifluoride (DAST) (50.1 μL, 1.0 mmol, 5.0 equiv). The reaction mixture was stirred for 6 h at 23 ଌ then quenched with 5% aqueous NaHCO3 (15 mL) and extracted with CH2Cl2 (3 × 30 mL). The combined organic layers were dried (NaSO4) and concentrated. Purification by flash chromatography (50:1 CH2Cl2–MeOH) afforded the title compound (20 mg, 31%) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 8.32 (s, 1H), 8.16 (s, 1H), 6.25 (dd, J = 15.6, 1.6 Hz, 1H), 6.05 (s, 2H), 5.32 (dd, J = 52.8, 1.6 Hz, 1H), 4.73𠄴.64 (m, 1H), 4.16𠄴.12 (m, 1H), 4.02 (dd, J = 12.0, 2.4 Hz, 1H), 3.79 (dd, J = 12.0, 2.4 Hz, 1H), 0.93 (s, 9H), 0.89 (s, 9H), 0.14 (s, 3H), 0.13 (s, 3H), 0.08 (s, 3H), 0.06 (s, 3H) 13 C NMR (75 MHz, CDCl3) δ 155.8, 153.3, 149.4, 139.3, 120.1, 93.0 (d, J = 191.3 Hz), 87.0 (d, J = 33.0 Hz), 84.0, 69.4 (d, J = 15.8 Hz), 61.3, 26.0, 25.8, 18.5, 18.2, 𢄤.6, 𢄤.9, 𢄥.3, 𢄥.4 MS (ESI+) calcd for C22H41FN5O3Si2 [M+H] + 498.3, found 498.3.

4.1.11. 3′-O-(tert-Butyldimethylsilyl)-2′-deoxy-2′-fluoroadenosine (17)

To a solution of 16 (100 mg, 0.20 mmol) in THF (0.5 mL) was added 35% aqueous 7 TFA (2 mL) at 23 ଌ. The solution was stirred for 20 min, then quenched with saturated aqueous NaHCO3 solution. The mixture was extracted with EtOAc (3 × 10 mL) and the combined extracts were dried (NaSO4), and concentrated. Purification by flash chromatography (50:1 CH2Cl2–MeOH) afforded the title compound (71 mg, 92%) as a white solid: 1 H NMR (400 MHz, CD3OD) δ 8.37 (s, 1H), 8.19 (s, 1H), 6.27 (dd, J = 15.2, 4.0 Hz, 1H), 5.51 (dt, J = 52.8, 4.0 Hz, 1H), 4.79𠄴.72 (m, 1H), 4.15 (d, J = 2.0 Hz, 1H), 3.90 (d, J = 12.4 Hz, 1H), 3.71 (dd, J = 12.8, 2.4 Hz, 1H), 0.96 (s, 9H), 0.18 (s, 3H), 0.17 (s, 3H) 13 C NMR (75 MHz, DMSO-D6) δ 156.2, 152.6, 148.8, 139.6, 119.2, 92.3 (d, J = 189.0 Hz), 85.7 (d, J = 32.3 Hz), 84.7, 70.0 (d, J = 15.0 Hz), 60.3, 25.6, 17.9, 𢄤.9, 𢄥.1 MS (ESI+) calcd for C16H27FN5O3Si [M+H] + 384.2, found 384.2.

4.1.12. 3′-O-(tert-Butyldimethylsilyl)-2′-deoxy-2′-fluoro-5′-O-(sulfamoyl)adenosine (18)

To a solution of 17 (100 mg, 0.26 mmol, 1.0 equiv) in 1,4-dioxane (5 mL) was added NaH (60 dispersion w/w in mineral oil, 32 mg, 0.78 mmol, 3.0 equiv) at 23 ଌ. After 1h, NH2ASI QUE2Cl 27 (75 mg, 0.65 mmol, 2.5 equiv) was added and the solution was stirred for 16 h at 23 ଌ. The reaction was quenched by the slow addition of 5:1 CH2Cl2–MeOH (10 mL) then the mixture was filtered through silica gel and the filtrate was concentrated. Purification by flash chromatography (30:1 CH2Cl2–MeOH) afforded the title compound (72 mg, 60%) as a white solid: 1 H NMR (300 MHz, CD3OD) δ 8.26 (s, 1H), 8.21 (s, 1H), 6.31 (dd, J = 17.1, 2.7 Hz, 1H), 5.53 (ddd, J = 52.5, 4.5, 2.7 Hz, 1H), 4.94𠄴.91 (m, 1H), 4.46𠄴.40 (m, 1H), 4.32𠄴.26 (m, 2H), 0.97 (s, 9H), 0.21 (s, 3H), 0.19 (s, 3H) 13 C NMR (75 MHz, DMSO-D6) δ 156.2, 152.8, 148.8, 139.7, 119.1, 92.2 (d, J = 187.5 Hz), 86.1 (d, J = 33.8 Hz), 80.3, 70.2 (d, J = 15.0 Hz), 67.7, 25.6, 17.8, 𢄤.9, 𢄥.1 MS (ESI+) calcd for C16H28FN6O5SSi [M+H] + 463.2, found 463.2.

4.1.13. 2′-Deoxy-2′-fluoro-5′-O-[norte-((R)-2-Hydroxy-3,3-dimethylbutanoyl)sulfamoyl] adenosine (3)

To a solution of 18 (140 mg, 0.30 mmol, 1.0 equiv) in DMF (8 mL) was added 9 (196 mg, 0.60 mmol, 2.0 equiv) and Cs2CO3 (206 mg, 0.60 mmol, 2.0 equiv) at 23 ଌ. The reaction mixture was stirred for 20 h at 23 ଌ, then concentrated in vacuo. The residue was purified by flash chromatography (500:6:1.5 CH2Cl2–MeOH𠄾t3N) to afford 3′-O(tert-butyldimethylsilyl)-5′-O-<norte-[(R)-2-(tert-butyldimethylsilyloxy)-3,3-dimethylbutanoyl] sulfamoyl>-2′-deoxy-2′-fluoroadenosine triethylammonium salt (80 mg) as a yellow solid. The compound was dissolved in 80% aqueous TFA (1 mL) and the solution was stirred at 20 ଌ for 72 h. The solvent was removed in vacuo. Purification by flash chromatography (10:1 CH2Cl2–MeOH) afforded the title compound (5.0 mg, 4% yield from 18) as a white solid: 1 H NMR (400 MHz, CD3OD) δ 8.56 (s, 1H), 8.30 (s, 1H), 6.68 (d, J = 6.8 Hz, 1H), 4.97 (dd, J = 51.6, 4.4 Hz, 1H), 4.86𠄴.82 (m, 2H), 4.76 (dd, J = 14.0, 2.8 Hz, 1H), 4.50 (dt, J = 18.8, 4.4 Hz, 1H), 3.63 (s, 1H), 0.98 (s, 9H) 13 C NMR (100 MHz, CD3OD) δ 179.1, 158.7, 150.4, 141.0, 140.5, 121.3, 94.3 (d, J = 192.0 Hz), 92.4 (d, J = 31.0 Hz), 84.8, 80.2 (d, J = 7.0 Hz), 71.5 (d, J = 16.0 Hz), 59.5, 36.2, 26.5 HRMS (ESI–) calcd for C16H22FN6O7S [M–H] – 461.1260, found 461.1280.

4.1.14. 5′-O-[norte-((R)-2-Hydroxy-3,3-dimethylbutanoyl)sulfamoyl]aristeromycin (4)

To a solution of 19 31 (89 mg, 0.19 mmol, 1.0 equiv) in DMF (5 mL) was added 9 (128 mg, 0.38 mmol, 2.0 equiv) and Cs2CO3 (122 mg, 0.38 mmol, 2.0 equiv). The reaction mixture was stirred for 20 h at 23 ଌ then concentrated in vacuo. The residue was purified by flash chromatography (500:8:1.5 CH2Cl2–MeOH𠄾t3N) to afford 5′-O-<norte-[(R)-2-(tert-butyldimethylsilyl)oxy-3,3-dimethylbutanoyl]sulfamoyl>-2′,3′-O-isopropylidenearisteromycin triethylammonium salt (50 mg) as a yellow solid. The compound was dissolved in 80% aqueous TFA (1.0 mL) and the solution was stirred at 8 ଌ for 48 h. The solvent was removed in vacuo. Purification by flash chromatography (10:1 CH2Cl2–MeOH) afforded the title compound (6 mg, 7% yield from compound 19) as a white solid: 1 H NMR (400 MHz, CD3OD) δ 8.56 (s, 1H), 8.27 (s, 1H), 5.04 (d, J = 4.8 Hz, 1H), 4.93 (dd, J = 13.6, 3.6 Hz, 1H), 4.55 (dd, J = 13.6, 2.8 Hz, 1H), 4.11𠄴.07 (m, 1H), 4.02 (d, J = 4.8 Hz, 1H), 3.69 (s, 1H), 3.05𠄲.96 (m, 1H), 2.80 (d, J = 10.0 Hz, 1H), 2.04 (d, J = 14.4 Hz, 1H), 1.00 (s, 9H) 13 C NMR (100 MHz, CD3OD) δ 179.1, 158.6, 150.5, 143.5, 141.2, 121.7, 80.3, 77.5, 74.4, 67.4, 60.6, 44.0, 36.1, 33.5, 26.5 HRMS (ESI–) calcd for C17H25norte6O7S [M–H] – 457.1511, found 457.1510.

4.1.15. (4R)-5,5-Dimethyl-4-hydroxymethyl-2-phenyl-1,3-dioxane (22)

To a mixture of 21 32 (371 mg, 2.77 mmol, 1.0 equiv) and benzaldehyde dimethyl acetal (548 mg, 3.04 mmol, 1.1 equiv) in CH2Cl2 (300 mL) was added camphorsulfonic acid (50 mg, 0.28 mmol, 0.1 equiv) at 23 ଌ. The reaction mixture was refluxed for 24 h, then saturated NaHCO3 aqueous solution was added to adjust the pH to 7. The mixture was extracted with EtOAc, and the combined organic extracts were washed with saturated aqueous NaCl, dried (NaSO4), and concentrated. Purification by flash chromatography (6:1 petroleum ether𠄾tOAc) afforded the title compound (500 mg, 85%) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 7.52 (d, J = 6.8 Hz, 2H), 7.43𠄷.33 (m, 3H), 5.51 (s, 1H), 3.69𠄳.60 (m, 5H), 1.14 (s, 3H), 0.84 (s, 3H) 13 C NMR (100 MHz, CDCl3) δ 138.4, 129.2, 128.4, 126.4, 102.2, 86.0, 79.0, 61.6, 31.7, 21.5, 19.3 MS (ESI+) calcd for C13H19O3 [M+H] + 223.1, found 223.0.

4.1.16. (4R)-5,5-Dimethyl-2-phenyl-4-[(trifluoromethanesulfonyl)oxy]methyl-1,3-dioxane (23)

To a solution of 22 (135 mg, 0.61 mmol, 1.0 equiv) and Et3N (0.2 mL) in CH2Cl2 (5 mL) was added TsCl (173 mg, 0.91 mmol, 1.5 equiv) at 0 ଌ. The mixture was then warmed to 23 ଌ and stirred for 16 h. The solvent was removed in vacuo and the residue was purified by flash chromatography (10:1 petroleum ether𠄾tOAc) to afford the title compound (190 mg, 83%) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 7.80 (d, J = 8.0 Hz, 2H), 7.48𠄷.34 (m, 5H), 7.27 (d, J = 8.0 Hz, 2H), 5.43 (s, 1H), 4.28 (dd, J = 10.8, 2.0 Hz, 1H), 4.11𠄴.03 (m, 1H), 3.91𠄳.85 (m, 1H), 3.65 (dd, J = 30.0, 11.2 Hz, 2H), 2.43 (s, 3H), 1.10 (s, 3H), 0.87 (s, 3H) 13 C NMR (100 MHz, CDCl3) δ 144.8, 138.0, 132.9, 129.8, 129.0, 128.2, 128.0, 126.2, 101.6, 82.5, 78.5, 69.5, 31.8, 21.7, 21.4, 18.8 MS (ESI+) calcd for C20H24O5SNa [M+Na] + 399.1, found 399.0.

4.1.17. (4R)-4-Azidomethyl-5,5-dimethyl-2-phenyl-1,3-dioxane (24)

To a solution of 23 (185 mg, 0.49 mmol, 1.0 equiv) in DMF (3 mL) was added NaN3 (96 mg, 1.47 mmol, 3.0 equiv) and the mixture was refluxed at 100 ଌ for 16 h. The mixture was extracted with diethyl ether and the combined organic layers were dried (NaSO4), and concentrated. Purification by flash chromatography (10:1 petroleum ether𠄾tOAc) afforded the title compound (113 mg, 93%) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 7.55 (d, J = 6.8 Hz, 2H), 7.43𠄷.32 (m, 3H), 5.58 (s, 1H), 3.81 (d, J = 9.2 Hz, 1H), 3.74 (d, J = 11.2 Hz, 1H), 3.65 (d, J = 11.2 Hz, 1H), 3.46 (dd, J = 12.8, 9.2 Hz, 1H), 3.20 (d, J = 13.2 Hz, 1H), 1.16 (s, 3H), 0.84 (s, 3H) 13 C NMR (100 MHz, CDCl3) δ 138.1, 128.9, 128.3, 126.1, 101.7, 84.7, 78.8, 50.7, 32.3, 21.5, 18.9 MS (ESI+) calcd for C13H17norte3O2Na [M+Na] + 270.1, found 270.0.

4.1.18. (4R)-4-Aminomethyl-5,5-dimethyl-2-phenyl-1,3-dioxane (25)

To a solution of 24 (100 mg, 0.4 mmol, 1.0 equiv) in MeOH (3 mL) under nitrogen was added 10% w/w Pd/C (20 mg). The nitrogen atmosphere was replaced with an atmosphere of H2 and the mixture was stirred at 23 ଌ for 2 h. The reaction mixture was then filtered through Celite washing with MeOH and the filtrate was concentrated to afford the title compound (67 mg, 75%) as a white solid: 1 H NMR (400 MHz, CDCl3) 1 H NMR (300 MHz, CDCl3) δ 7.56𠄷.28 (m, 5H), 5.47 (s, 1H), 3.89 (br s, 2H), 3.60𠄳.52 (m, 3H), 2.88𠄲.67 (m, 2H), 1.08 (s, 3H), 0.78 (s, 3H) 13 C NMR (75 MHz, CDCl3) δ 138.6, 128.8, 128.2, 126.1, 101.9, 87.5, 78.8, 41.4, 32.0, 21.4, 19.0 MS (ESI+) calcd for C13H20NO2 [M+H] + 222.1, found 222.2.

4.1.19. 4-Nitrophenyl-[((4R)-5,5-dimethyl-2-phenyl-1,3-dioxan-4-yl)methyl]sulfamate (26)

To a solution of 25 (60 mg, 0.27 mmol, 1.0 equiv) and 4-nitrophenol (375 mg, 2.7 mmol, 10.0 equiv) in CH2Cl2 (3 mL) was added 4-nitrophenyl chlorosulfate (192 mg, 0.81 mmol, 3.0 equiv) dropwise in CH2Cl2 (3 mL) at � ଌ. The reaction was stirred 2 h at � ଌ, then diluted with CH2Cl2 and warmed to 23 ଌ followed by consecutive washes with 1 M NaH2correos4 y H2O. The organic layer was dried (Na2ASI QUE4) and concentrated. Purification by flash chromatography (50:1 CH2Cl2–MeOH) afforded the title compound (60 mg, 50%) as a white solid: 1 H NMR (400 MHz, CDCl3) δ 8.09 (d, J = 9.2 Hz, 2H), 7.50𠄷.33 (m, 7H), 5.45 (s, 1H), 3.80𠄳.70 (m, 2H), 3.61 (d, J = 11.2 Hz, 1H), 3.57𠄳.49 (m, 1H), 3.32𠄳.21 (m, 1H), 1.20 (s, 3H), 0.89 (s, 3H) 13 C NMR (100 MHz, CDCl3) δ 154.3, 145.8, 137.7, 129.5, 128.4, 126.4, 125.4, 122.6, 102.1, 82.8, 78.3, 44.1, 31.9, 21.1, 18.7 MS (ESI+) calcd for C19H22norte2O7SNa [M+Na] + 445.1, found 444.8.

4.1.20. 5′-Amino-5′-deoxy-5′-norte-[norte-((R)-2,2-dimethylbutane-1,3-diol-4-yl)sulfamoyl] adenosine (5)

To a mixture of 26 (120 mg, 0.28 mmol, 1.0 equiv) and 27 33 (167 mg, 0.56 mmol, 2.0 equiv) in CH2Cl2 (10 mL) at 23 ଌ was added 4Å molecular sieves (80 mg) and Et3N (0.40 mL, 2.80 mmol, 10 equiv). The reaction was stirred for 24 h, then filtered and the filtrate concentrated. Purification by flash chromatography (40:1 CH2Cl2–MeOH) afforded 5′-amino-5′-deoxy-5′-norte-(norte-<[(2R,4R)-5,5-dimethyl-2-phenyl-1,3-dioxan-4-yl]methylamino> sulfamoyl)-2′,3′-O-isopropylideneadenosine (100 mg) as a white solid. The compound was dissolved in 80% aqueous TFA (2 mL) at � ଌ. After stirring 4 h at � ଌ, the solution was concentrated in vacuo. Purification by flash chromatography (10:1 CH2Cl2–MeOH) afforded the title compound (5 mg, 4% yield from 26) as a white solid: 1 H NMR (400 MHz, CD3OD) δ 8.28 (s, 1H), 8.23 (s, 1H), 5.90 (d, J = 6.8 Hz, 1H), 4.91𠄴.89 (m, 1H), 4.36 (dd, J = 5.2, 2.0 Hz, 1H), 4.32𠄴.28 (m, 1H), 3.64𠄳.55 (m, 2H), 3.40𠄳.34 (m, 3H), 3.16 (dd, J = 12.4, 2.0 Hz, 1H), 2.85 (dd, J = 12.8, 10.0 Hz, 1H), 0.81 (s, 3H), 0.78 (s, 3H) 13 C NMR (100 MHz, CD3OD) δ 157.6, 153.9, 150.0, 142.5, 121.2, 91.6, 85.9, 76.3, 74.3, 73.0, 70.2, 46.1, 45.8, 39.6, 21.8, 20.1 HRMS (ESI–) calcd for C16H26norte7O7S [M–H] – 460.1620, found 460.1635.

4.2 Pantothenate Synthetase Assay

4.2.1. Materiales

Pantoic acid was synthesized as described by Rychlik, 42 7-methyl-6-thioguanosine (MesG) was purchased from Berry and Associates (Dexter, MI, USA), E. coli TOPO and BL21(DE3) cells are from Invitrogen (Carlsbad, CA, USA), restriction enzymes and Taq polymerase are from New England Biolabs (Ipswich, MA, USA), the vectorpET28b is from EMD Biosciences (San Diego, CA, USA), the primers for PCR are from Integrated DNA Technologies (Coralville, IA, USA) and the PFU polymerase is from Agilent Technologies (Wilmington, DE, USA). All other chemicals, biological buffers, and the coupling enzymes inorganic pyrophosphatase (I1643) and purine nucleoside phosphorylase (N8264) were purchased from Sigma-Aldrich (St. Louis, MO).

4.2.2. Cloning, Expression and Purification of Recombinant PanC from Tuberculosis micobacteriana

PanC (Rv3602c) was amplified from the H37Rv BAC Rv222 using PFU turbo and the primers GCGAGCAACCACATCGTCAC and CGACTTCAGCATCGTCCGTAAC. The PCR product was treated with Taq using standard procedures to add 3′ overhanging adenosine residues and then cloned into pCR2.1-TOPO. The resulting plasmid (pCDD22) was used as template to amplify the expression construct using the primers GG CATATG ACGATTCCTGCGTTCCATCCC and GCTC AAGCTT CAGTTTCTCCAATGTGATTCGAGGATTGCCCGG containing the restriction sites NdeI y HindIII respectively (underlined). The resulting PCR product was cloned into pCR2.1 giving plasmid pCDD23. The construct was digested using NdeI y HindIII and ligated into similarly digested pET28b yielding pCDD24. The recombinant plasmid pCDD24 was transformed into E. coli BL21 (DE3) electrocompetent cells and streaked-out on a Luria Bertani (LB) agar plate with 100 μg mL 𢄡 of kanamycin and incubated overnight at 37 ଌ. A single colony was selected to inoculate 50 mL of LB with 100 μgmL 𢄡 of kanamycin to be used as a starting culture.

Terrific Broth (TB) cultures (4 L) were supplemented with 100 μg mL 𢄡 kanamycin, and 10 mL of an overnight starting culture added to the media. The cultures were grown at 37 ଌ until an OD600 of 0.5 and then induced with 0.5 mM of isopropyl β-D-1-thiogalactopyranoside (IPTG) for 4 h at 30 ଌ. The cells were centrifuged at 6000gramo for 30 min and the pellets were stored at � ଌ. The frozen pellets were thawed in lysis buffer (50 mM HEPES, 300 mM NaCl, 10 mM imidazole, pH 8.0) and the cells were disrupted by sonication on a Branson Sonifier (5 × 2min, 30% duty cycle, power 8) and centrifuged for 30 min at 50,000gramo to remove cell debris. To the supernatant was added 1 mL of 50% Ni-NTA agarose resin in 30% ethanol (Qiagen) and the final solution was incubated at 4 ଌ for 1 h. The sample was then loaded onto a gravity column and the resin was washed with 15 mL of wash buffer (50 mM HEPES, 300 NaCl, 20 mM imidazole, pH 8.0) and eluted with 2.5 mL of elution buffer (50 mM HEPES, 300 NaCl, 250 mM imidazole, pH 8.0). In order to remove the imidazole from the sample, a desalting column (PD-10, GE HealthCare, Piscataway NJ, USA) was used with the storage buffer (10 mM HEPES [pH 8.0], 1 mM EDTA, 5% glycerol). Protein concentrations were determined using ε280 = 15,930 M 𢄡 cm 𢄡 for the native PanC with a hexa-histidine tag and the final yield of this protocol provided approximately 45 mg per liter of cell culture.

4.2.3. In vitro Inhibition Studies

Kinetic studies to evaluate PanC inhibition of each compound were performed under initial velocity conditions using the MesG coupled assay (EnzChek pyrophosphatase assay, Invitrogen) with 400 nM PanC, 100 mM HEPES (pH 8.0), 2.4 mM β-alanine, 10 mM MgCl2, 0.04 unit of pyrophosphatase, 0.1 unit of purine nucleoside phosphorylase, 0.2 mM 7-methyl-6-thioguanosine (MesG) and varying concentrations of inhibitor, pantoic acid, and ATP in a total volume of 100 μL containing up to 5% DMSO. Reactions were initiated by addition of PanC. In this coupled assay, pyrophosphate generated from the PanC reaction is converted to phosphate by pyrophosphatase. Purine nucleoside phosphorylase then catalyzes the phosphorolysis of the substrate 7-methyl-6-thioguanosine (MesG) to the chromogenic product 7-methyl-6-thioguaninethat is measured by an increase in absorbance at 360 nm. Experiments were performed in 96-well plates (UV Half Area plate with Transparent Bottom-Corning) and formation of 7-methyl-6-thioguaninewas measured at 360 nm (ε360 = 11,000 M 𢄡 cm 𢄡 ) at 25 ଌ on a microplate reader.

For experiments to determine the apparent inhibition constants with respect to pantoic acid, the initial rates were measured at varying concentrations (50, 100, 130, 180, 240 and 300μM) of pantoic acid with 2.6 mM ATP and 2.4 mM β-alanine at different fixed levels of the inhibitors [inhibitor 1a (0, 0.4, 0.8 and 1 μM), inhibitor 2 (0, 0.08, 0.12 and 0.16 μM), inhibitor 3 (0, 0.2, 0.4 and 0.6 μM), inhibitor 4 (0, 0.2, 0.4 and 0.5 μM) and inhibitor 5 (0, 0.8, 1.6 and 2 μM)]. Inhibition data were fit to equation 1:

dónde I is the inhibitor concentration, S is the substrate concentration, Km is the Michaelis-Menten constant, Vmax is the maximal velocity, KI is the competitive inhibition constant. 37

4.3. Modeling Studies

The three-dimensional structures of the aforementioned compounds were constructed using Chem. 3D ultra 12.0 software [Chemical Structure Drawing Standard Cambridge Soft corporation, USA (2010)], which were then energetically minimized by using Tripos force field with 5000 iterations and minimum RMS gradient of 0.05 prior to docking. The crystal structures of pantothenate synthetase (M. tuberculosis. y E. coli) (PDB code: 3IVG.pdb) complex were retrieved from the RCSB Protein Data Bank (http://www.rcsb.org/pdb/home/home.do). All bound waters were eliminated from the protein and hydrogens were added to the protein. Each ligand was docked into the active site of pantothenate synthetase using the Surflex-Dock suite of SYBYL 1.3.

4.4. Mtb whole-cell assays

Whole-cell screening of 1𠄵 was carried out against wildtype H37RvMA 43 and the panC-depleted strain as previously described. 38 Briefly, cells were grown to an OD600 de

0.2 in 7H9 medium prior to 500-fold dilution. En el caso de la panC knockdown, the medium was supplemented with Hygromycin B (Hyg 50 μg/mL), Kanamycin (Km 25 μg/mL) and Gentamicin (Gm 5 μg/mL) in order to facilitate maintenance of the regulatory vectors. Using a starting concentration of 4 mM, 2-fold serial dilutions of each inhibitor were performed in 96-well microplates containing 50 μL 7H9 medium, supplemented with Hyg (25 μg/mL), Km (12.5 μg/mL) and Gm (2.5 μg/mL) where appropriate, in both the presence and absence of anhydrotetracycline (ATc 20 ng/mL) alone or ATc (20 ng/mL) together with pantothenate (50 μg/mL). A volume of 50 μL of the diluted cell suspension was added to each well, yielding a final volume of 100 μL per well. Plates were incubated at 37 ଌ and growth was observed visually following 7, 10 and 14 days of incubation.

Reagents and conditions: (i) LiAlH4, THF, 0 ଌ, 2 h, 58% (ii) PhCH(OEt)2, CSA, CH2Cl2, reflux, 24 h, 85% (iii) TsCl, Et3N, CH2Cl2, 16 h, 83% (iv) NaN3, DMF, reflux, 16 h, 93% (v) H2, Pd/C, MeOH, 2 h, 75% (vi) 4-nitrophenyl chlorosulfate, CH2Cl2, � ଌ, 2 h, 50% (vii) 27, Et3N, CH2Cl2, 4 Å molecular sieves (viii) 4:1 TFA–H2O, � ଌ, 4 h, 4% from 26.