Información

¿Qué significan ΔC y ΔN con respecto a una secuencia de proteínas?

¿Qué significan ΔC y ΔN con respecto a una secuencia de proteínas?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Estoy leyendo un artículo sobre la regulación de la exportación nuclear de la proteína GSK3 y me he encontrado con la siguiente afirmación:

MFrat1 (FLAG-Frat) etiquetado con epítopo FLAG de longitud completa y la mitad amino-terminal de Frat (ΔC Frat) se localiza predominantemente en el citoplasma de células MDCK transfectadas (Fig. 1, A y B, i y iii). Inesperadamente, la mitad carboxilo-terminal de Frat (ΔN Frat) se acumuló preferentemente en los núcleos de las células transfectadas (Fig. 1B, iv).

No estoy seguro de por qué la mitad amino-terminal y carboxilo-terminal de la proteína Frat se denominan ΔC Frat y ΔN Frat respectivamente. Sé que el término amino de una proteína también se conoce como el término N, mientras que el término carboxilo de una proteína se conoce como el término C. No estoy seguro de por qué en este artículo ΔC y ΔN se utilizan para referirse a la mitad amino-terminal y carboxilo-terminal de la proteína Frat.

Se agradece cualquier información.


La proteína Frat / GBP (frecuentemente reordenada en linfomas de células T / proteína de unión a GSK-3) es un protooncogén que regula la vía de señalización Wnt. (van Amerongen et al., 2004)

El artículo citado (Franca-Koh, 2002) señaló una correlación entre algunas formas de localización celular Frat y GSK3. Sin Frat, GSK3 es citoplasmático. En presencia de Frat, el heterodímero Frat-GSK3 se transloca al núcleo. Como Frat está fosforilado, no estaba claro qué mecanismos estaban involucrados. Para investigar el papel de Frat, los autores plantearon la hipótesis de que podría estar involucrada una región de Frat, no necesariamente toda la proteína.

Diseñaron construcciones de deleción y agregaron un norte-Etiqueta FLAG terminal para una fácil purificación por afinidad. Utilizaron el símbolo delta (Δ) para la eliminación. los norte-región terminal de los residuos 1-129 que abarcan el dominio 1, es decir. eliminación de la C-la región terminal se llama ΔC; del mismo modo, el C-región terminal de los residuos 129-274 que abarca el dominio 2, es decir. eliminación de la norte-terminus se llama ΔN. También diseñaron una variante de proteína de fusión de etiqueta de proteína verde fluorescente (GFP). Aquí están sus construcciones como se ilustra en la Figura 1 de su artículo:

Ortólogo humano
Alineé la secuencia de residuos del Frat murino con los ortólogos humanos: tiene un 79% de identidad con Frat1 humano y un 68% de identidad con Frat2 humano. Los residuos de mFrat 1-129 (ΔC) y 129-274 (ΔN) corresponden a los residuos de hFrat1 1-132 y 132-279, respectivamente.

Nota agregada
Aquí hay una estructura de co-cristal de GSK3β (norte-lóbulo terminal en naranja y Clóbulo terminal en cian) complejado con el péptido Frat1 197-226 (verde bosque) y un inhibidor (norte- (6- (3,4-dihidroxifenil) -1H-pirazolo [3,4-B] piridina-3-yl) acetamida) (verde) depositado en RCSB como entrada 5OY4.pdb. La presencia del inhibidor ayuda a localizar el sitio activo en la imagen de la proteína quinasa GSK3b.

Referencias
Franca-Koh, J., Yeo, M., Fraser, E., Young, N. y Dale, T.C. (2002) J. Biol. Chem. 277:43844-43848.

Van Amerongen, R., van der Gulfen, H., Bleeker, F., Jonkers, J. y Berns, A. (2004) J. Biol. Chem. 279:26967-26974.


Las proteínas similares a Rilp Rilpl1 y Rilpl2 regulan el contenido de la membrana ciliar

El cilio primario es una estructura basada en microtúbulos que se encuentra en la mayoría de los tipos de células de los mamíferos. La alteración de la función del cilio provoca un conjunto diverso de enfermedades humanas conocidas colectivamente como ciliopatías. Divulgamos que las proteínas relacionadas con el efector Rab que interactúan con la proteína lisosomal tipo 1 (Rilpl1) y Rilpl2 regulan la localización de proteínas en el cilio primario. Rilpl2 se identificó inicialmente como regulado positivamente en células epiteliales traqueales de ratón ciliadas. Rilpl1 y Rilpl2 se localizan en el cilio primario y el centrosoma, Rilpl1 específicamente en el extremo distal del centríolo madre. La microscopía de células vivas revela que la localización del cilio primario de Rilpl2 es dinámica y que está asociada con estructuras tubulovesiculares en la base del cilio. El agotamiento de Rilpl1 y Rilpl2 da como resultado la acumulación de proteínas de señalización en la membrana ciliar e impide la organización adecuada de las células epiteliales en cultivos tridimensionales. Estos datos sugieren que las proteínas similares a Rilp funcionan en la regulación de la concentración de proteínas de la membrana ciliar promoviendo la eliminación de proteínas del cilio primario.


Introducción

En las células eucariotas, hay dos rutas principales al lisosoma / vacuola después de salir de la red trans-Golgi (TGN) (Hunziker y Geuze, 1996 Kornfeld y Mellman, 1989). Una es la vía biosintética por la cual la célula entrega enzimas lisosomales y proteínas de membrana recién sintetizadas para la biogénesis y el mantenimiento de lisosomas / vacuolas. Las vesículas de transporte que llevan las moléculas de carga brotan del TGN y se dirigen principalmente a los endosomas antes de llegar a los lisosomas / vacuolas. La otra ruta es la llamada ruta endocítica por la cual la célula entrega varios ligandos internalizados y los receptores de la membrana plasmática (PM) a los lisosomas / vacuolas para su degradación. Los complejos ligando-receptor, por ejemplo EGF / EGF-receptor, se segregan en las vesículas internas de los endosomas (Futter et al., 1996). Los subconjuntos de receptores que se reciclan de nuevo a la PM, como el receptor de transferrina y el receptor de lipoproteínas de baja densidad, se secuestran en vesículas recubiertas de clatrina en los endosomas de reciclaje y se eliminan de las vías degradativas. En ambas vías, los endosomas juegan un papel central en la clasificación de las moléculas de carga y, de hecho, los endosomas son lugares de encuentro para el tráfico de membranas de ambas rutas.

Mediante un extenso análisis genético en la levadura Saccharomyces cerevisiae, se aislaron más de 50 de los genes Vps (clasificación de proteínas vacuolares) implicados en el transporte de la membrana a las vacuolas (Raymond et al., 1992). La familia de Vps de clase E, uno de los subgrupos de mutantes de Vps, exhibe un grado modesto de secreción de carboxipeptidasa Y (CPY) recién sintetizada, una enzima vacuolar soluble, en comparación con otras subclases de mutantes de Vps. En los mutantes de Vps de clase E, tanto la subunidad V-ATPasa de 60 kDa como el colorante FM4-64, un trazador de las membranas endocíticas, parecen acumularse en nuevos compartimentos adyacentes a las vacuolas, los denominados "compartimentos de clase E". Uno de los mutantes de clase E Vps, vps4, acumula marcadores vacuolares, endocíticos y de Golgi tardío en un compartimento prevacuolar multilaminar aberrante. La microscopía electrónica reveló que tras un cambio de temperatura, se acumulan pilas exageradas de membranas cisternal curvadas adyacentes a las vacuolas en el vps4ts mutante (Babst et al., 1997). Estas estructuras de membrana aberrantes que se encuentran en vps4 corresponden a un compartimento típico de clase E. Sobre la base de estas y otras observaciones, se cree que la función de Vps4p es necesaria para un transporte eficaz fuera del endosoma prevacuolar. Se ha clonado el gen VPS4 y se ha descubierto que codifica una proteína de 48 kDa que pertenece a la familia de proteínas de las ATPasas de tipo AAA (ATPasa asociada con actividades celulares) (Babst et al., 1998). Los análisis bioquímicos de Vps4p y su mutante defectuoso en la hidrólisis de ATP revelaron que la forma libre de nucleótidos o unida a ADP de Vps4p existe como un dímero, mientras que en el estado unido a ATP, los dímeros de Vps4p se ensamblaron en un complejo decamérico. Esto sugiere que la hidrólisis de ATP impulsa un ciclo de ensamblaje y desensamblaje de dímeros / decámeros de Vps4p, así como la asociación de Vps4p con un compartimento endosómico in vivo. Además, las asociaciones de membrana de otras dos proteínas Vps de clase E, Vps24p y Vps32p / Snf7p, también se ven afectadas por mutaciones en VPS4.

Se ha demostrado que dos Vps4ps de mamíferos, SKD1 / Vps4B y Vps4A, están implicados en el transporte de membrana a través de endosomas (Bishop y Woodman, 2000 Yoshimori et al., 2000). Anteriormente hemos demostrado que la sobreexpresión de SKD1 (E235Q), la forma deficiente en ATPasa de SKD1 (supresor del defecto de crecimiento del transporte de potasio 1), provocó la perturbación de varios transportes de membrana a través de los endosomas (Fujita et al., 2003). Por ejemplo, los receptores de reciclaje se acumulan en los compartimentos E235Q, los endosomas aberrantes inducidos por SKD1 (E235Q). El reciclaje de endolino y TGN38, de PM a lisosomas y TGN, respectivamente, también se ve gravemente anulado por la expresión de SKD1 (E235Q). Como resultado de la acumulación del receptor de manosa-6-fosfato (MPR) en los compartimentos E235Q, una enzima lisosomal sintetizada recientemente, la catepsina D, se secretó al exterior de las células. Estos fenotipos dirigidos por la expresión de SKD1 (E235Q) se parecían a los encontrados en los mutantes Vps de clase E en levadura. SKD1 (E235Q) también provocó la acumulación de orgánulos híbridos, los compartimentos intermedios en el transporte de la membrana entre los endosomas tardíos y los lisosomas. Aunque se considera que la actividad ATPasa de SKD1 es de vital importancia para el transporte de membrana a través de los endosomas, su función molecular aún se conoce poco. En este estudio, hemos clonado y caracterizado dos proteínas Vps de clase E de mamíferos. Proponemos que son necesarios para la función de SKD1 en el transporte de membrana a través de endosomas.


¿Qué significan ΔC y ΔN con respecto a una secuencia de proteínas? - biología

Informamos anteriormente que el gen de respuesta temprana al etileno del tabaco NtER1 codifica una proteína de unión a calmodulina (Yang, T. y Poovaiah, B. W. (2000) J. Biol. Chem. 275, 38467–38473). Aquí demostramos que hay unoNtER1 homólogo, así como cinco genes relacionados enArabidopsis. Estos seis genes son inducidos rápida y diferencialmente por señales ambientales como temperaturas extremas, UVB, sal y hormonas que causan heridas como etileno y ácido abscísico y moléculas de señal como metil jasmonato, H2O2y ácido salicílico. Por lo tanto, fueron designados como AtSR1–6 (A rabidopsisthaliana signal-rgenes espontáneos). Ca 2+ / calmodulina se une a todas las AtSR, y sus regiones de unión a calmodulina están ubicadas en un motivo α-helicoidal anfifílico básico conservado en el extremo C terminal. AtSR1 se dirige al núcleo y reconoce específicamente una nueva caja CGCG de 6 pb (A / C / G) CGCG (G / T / C). El CGCG múltiple cisLos elementos -se encuentran en los promotores de genes como los implicados en la señalización del etileno, la señalización del ácido abscísico y la percepción de la señal luminosa. El dominio de unión al ADN en AtSR1 se encuentra en el terminal N de 146 pb, donde todas las proteínas relacionadas con AtSR1 comparten una gran similitud pero no tienen similitud con otras proteínas de unión al ADN conocidas. Las proteínas nucleares de unión a calmodulina aisladas de hojas heridas exhiben actividades específicas de unión al ADN de la caja CGCG. Estos resultados sugieren que el AtSR La familia de genes codifica una familia de proteínas que se unen a la calmodulina / que se unen al ADN involucradas en múltiples vías de transducción de señales en plantas.

Este trabajo fue financiado por la subvención 2002-00741 del Departamento de Agricultura de los Estados Unidos, la subvención MCB 96-3033 de la Fundación Nacional de Ciencias y la subvención NAG-10-0061 de la Administración Nacional de Aeronáutica y del Espacio. pago de cargos por página. Por lo tanto, el artículo debe estar marcado como “anuncio publicitario”De acuerdo con 18 U.S.C. Sección 1734 únicamente para indicar este hecho.

La versión en línea de este artículo (disponible en http://www.jbc.org ) contiene la Fig.1.

La (s) secuencia (s) de nucleótidos informada en este documento se ha enviado al banco de datos GenBank ™ / EBI con número (s) de acceso AF506697.


¿Qué significan ΔC y ΔN con respecto a una secuencia de proteínas? - biología

El receptor eliminador de clase A (SR-A) es una glicoproteína transmembrana multifuncional que está implicada en la aterogénesis, la inmunidad innata y la adhesión celular. A pesar de los extensos estudios de estructura-función del receptor, no se han determinado las moléculas intracelulares que interactúan directamente con SR-A y regulan el tráfico del receptor. En el estudio actual, hemos identificado una proteína de unión a microtúbulos, Hook3, como un nuevo socio de interacción de SR-A. La asociación entre una isoforma Hook3 de rata y SR-A fue sugerida por el cribado de dos híbridos de levadura y el análisis de espectrometría de masas de proteínas unidas al dominio citoplásmico de SR-A en macrófagos alveolares de rata. La unión de Hook3 humano endógeno y sobreexpresado a SR-A se demostró mediante un ensayo de reducción y co-inmunoprecipitaciones. Además, SR-A y HK3 murinos endógenos co-sedimentaron a partir de lisados ​​celulares aislados de células de macrófagos murinos Raw264.7. La interacción de Hook3 con SR-A se estimuló significativamente después de que SR-A reconoció el ligando extracelular. Los estudios que utilizaron truncamientos demostraron que la región C-terminal Val 614-Ala 717 cargada positivamente del Hook3 humano era necesaria para la interacción con los residuos cargados negativamente, Glu 12, Asp 13 y Asp 15 en el dominio citoplásmico SR-A humano. Mediante la transfección de pequeños ARN de interferencia dirigidos a Hook3, la expresión total y superficial, la absorción de ligando mediada por receptor y la estabilidad de la proteína de SR-A se promovieron significativamente, mientras que la síntesis y maduración de proteínas no se alteraron. Proponemos por primera vez que Hook3 puede participar en la renovación del receptor eliminador endocitosed.

Este trabajo fue apoyado en parte por una subvención para investigación científica del Ministerio de Educación, Ciencia, Deportes y Cultura, Japón, y la Fundación Akiyama. Los costos de publicación de este artículo fueron sufragados en parte por el pago de cargos por página. Por lo tanto, este artículo debe estar marcado como “anuncio publicitario”De acuerdo con 18 U.S.C. Sección 1734 únicamente para indicar este hecho.

Con el apoyo de la subvención I-1300 de la Fundación Welch y la subvención NS43406 de los Institutos Nacionales de Salud.


En la teoría de los nudos se estudian las "clases de isotopías" de los nudos, lo que, intuitivamente, significa que los nudos se consideran como lo mismo si uno puede deformarse en el otro sin introducir autocruces (la definición real es más compleja). Los nudos poligonales son fáciles de captar y amigables con la computadora, ya que describir tal nudo equivale a prescribir un número finito de conjuntos de coordenadas. Eche un vistazo aquí y aquí para ver implementaciones reales.

Por otro lado, usar nudos suaves es más intuitivo (¡las cuerdas de tus zapatos o los nudos que usan los marineros y otros se parecen más a los nudos lisos que a los poligonales!). Sin embargo, siempre se puede reemplazar un nudo liso con uno poligonal y viceversa sin cambiar su clase de isotopía. Creo que si eliges cualquier libro sobre nudos, te explicará por qué es así. (Pruebe "The Knot Book: An Elementary Introduction to the Mathematical Theory of Nudos" de Colin Adams; consulte también aquí para obtener más sugerencias.) Intuitivamente, se aproxima una función uniforme por una función lineal por partes, a la inversa, dado un nudo poligonal "suave las esquinas "para hacer un nudo suave.

Vea también esta y esta publicación de MSE sobre esta relación bidireccional.

En cualquier escenario, para recuperar información completa sobre la clase de isotopía de un nudo, basta con dibujar su diagrama en el plano (liso o poligonal, no importa) y prescribir qué intersecciones son sobrecruces y cuáles son subcruces.


Introducción

Una gran cantidad de evidencia de en vivo y en organello estudios (Cantatore y Attardi, 1980 Montoya et al., 1982, 1983 Yoza y Bogenhagen, 1984 Gaines y Attardi, 1984a, b Gaines et al., 1987) ha indicado que el mecanismo subyacente a la expresión de 20 a 50 veces mayor de la región del gen del ARNr en relación con los genes posteriores transcritos de la cadena pesada (H) del ADN mitocondrial (ADNmt) (Gelfand y Attardi, 1981) Implica la actividad diferencial de dos unidades de transcripción superpuestas controladas de forma independiente que comienzan en dos sitios de iniciación ubicados muy cerca en la región del bucle D (Montoya et al., 1983). Además de estar regulada a nivel de iniciación de la transcripción, esta expresión diferencial de las dos unidades de transcripción implica un fenómeno de atenuación en el límite entre los genes 16S rRNA y tRNA Leu (UUR) (Christianson y Clayton, 1988 Kruse et al., 1989). Un papel central en esta atenuación lo desempeña el factor de terminación de la transcripción mitocondrial (mTERF), una proteína de unión al ADN que protege una región de 28 pb dentro del gen tRNA Leu (UUR) en una posición inmediatamente adyacente y aguas abajo del gen rRNA 16S. (Kruse et al., 1989) esta región comprende una secuencia tridecamer crítica para dirigir una terminación precisa (Christianson y Clayton, 1988). En un in vitro sistema de transcripción que utiliza un lisado mitocondrial, se ha encontrado que mTERF promueve la terminación en el límite del gen 16S rRNA-tRNA Leu (UUR) de las transcripciones de la cadena H que comienzan en el sitio de inicio específico del rRNA (Kruse et al., 1989 ).

Una caracterización molecular de mTERF ha demostrado recientemente que su actividad de huella específica está asociada con tres polipéptidos relacionados con la secuencia, es decir, dos polipéptidos de ∼34 kDa y un polipéptido de 31 kDa, mientras que la actividad promotora de terminación parece residir solo en el 34 Componentes kDa (Daga et al., 1993). La comprensión del papel funcional de mTERF ha adquirido un significado especial después de la demostración de que una transición A → G en el medio del segmento de mtDNA protegido por mTERF está asociada con la encefalomiopatía MELAS (Goto et al., 1990 Kobayashi et al., 1990), con oftalmoplejía externa progresiva (PEO) (Johns y Hurko, 1991) y con algunas formas de diabetes de inicio en la edad adulta (Van den Ouweland et al., 1992), y que esta mutación reduce drásticamente la afinidad de unión de mTERF por su secuencia diana (Hess et al., 1991 Chomyn et al., 1992 ).

En el presente trabajo, el ADNc de mTERF ha sido clonado y secuenciado, y el NH2Se han identificado los extremos de los precursores y de la proteína madura. La proteína recombinante madura, aunque exhibe la capacidad de unión al ADN específica esperada, es incapaz de promover la terminación de la transcripción en un in vitro sistema, apuntando a otro (s) componente (s) que se requieren para la actividad de terminación. Además, un análisis detallado de estructura-función de la in vitro mTERF sintetizado ha proporcionado evidencia de un nuevo motivo de unión al ADN, en el que tres cremalleras de leucina forman una espiral en espiral de tres hebras intramolecular que trae dos dominios básicos ampliamente separados en registro cercano con la secuencia de ADN diana de mTERF.


MATERIALES Y MÉTODOS

Cultivo de células

Las líneas celulares MCF10A, MCF7, MDA-MB-231 y HEK-293T se adquirieron de la American Type Culture Collection (Manassas, VA, EE. UU.), Donde todas las líneas celulares se caracterizan por huellas dactilares de ADN y detección de isoenzimas. Se cultivaron células MCF10A en DMEM / F12 complementado con suero de caballo al 5%, EGF 20 ng / ml, hidrocortisona 0,5 mg / ml, toxina del cólera 100 ng / ml, insulina 10 mg / ml y penicilina-estreptomicina 10 U / ml . Se cultivaron células MCF7 en medio RPMI-1640 (Sigma-Aldrich, St. Louis, MO, EE.UU.) suplementado con suero bovino fetal al 10% (FBS ExCell Bio, Shanghai, China). Se cultivaron células MDA-MB-231 en medio L-15 (Sigma-Aldrich) con FBS al 10%. Las células HEK-293T se cultivan en medio DMEM (Sigma-Aldrich) que contiene FBS al 10%. Todas las líneas celulares se cultivaron a 37 ° C con 5% de CO2 excepto MDA-MB-231, que se cultivó a 37 ° C sin CO2.

Anticuerpos y plásmidos

Se utilizaron los siguientes anticuerpos: anticuerpos contra E-cadherina, N-cadherina, vimentina, fibronectina, β-catenina (BD Biosciences, San José, CA, EE. UU.) Β-actina (Sigma-Aldrich), PRMT7, H3K4me3 (Upstate Biotechnology, Lake Placid, NY, EE. UU.) PRMT7, YY1 (Santa Cruz Biotechnology, Dallas, TX, EE. UU.) H4R3me2s (Active Motif, Carlsbad, CA, EE. UU.) Y Flag-tag (Abmart, Shanghai, China).

El plásmido 3 ∗ flag-PRMT7 que codifica 3 copias N-terminales de PRMT7 etiquetado con Flag (un obsequio del Dr. Graydon B. Gonsalvez, Case Western Reserve University, Cleveland, OH, EE. UU.) Se usó para construir el plásmido de expresión lentiviral pWPXLD- 3 ∗ flagPRMT7. Los plásmidos de expresión bacteriana que expresan un glutatión. SEl PRMT7 de tipo salvaje (WT) marcado con -transferasa (GST) (pGEX-6P-1-PRMT7 WT) se preparó insertando la secuencia de codificación de PRMT7 en el vector pGEX-6P-1 en el marco con la secuencia de codificación de GST. Se utilizaron técnicas de clonación estándar para generar PRMT7 R531F, PRMT7 R531K y PRMT7 Mut, en las que G74 y T75 se mutaron a plásmidos de alanina en vectores de expresión lentivirales o bacterianos.

Nocaut de PRMT7 mediado por CRISPR / Cas9

Se diseñó ARN de guía única (ARNsg) contra PRMT7 utilizando la herramienta CRISPRdirect (https://crispr.dbcls.jp/). La secuencia de 20 nucleótidos seguida de un motivo adyacente a un protoespaciador (PAM) 59-NGG-39 se utilizó como secuencia de siembra para el sgRNA. Las secuencias diana de sgRNA para PRMT7 fueron: guía 1: GTCGGGCCAATCCGACCACGGGG guía 2: AGTCG-GGCCAATCCGACCACGGG y guía 3: CAGTCGGGC-CAATCCGACCACGG. Todos los oligonucleótidos de sgRNA se clonaron en el vector lentiviral pLentiCRISPR predigerido con BsmBI.

Infección viral

Los vectores de empaquetamiento de lentivirus usados ​​fueron psPAX2 (Addgene, Cambridge, MA, EE.UU.) y pMD2.G (Addgene). La generación de lentivirus en células HEK-293T y la transfección de construcciones lentivirales en líneas celulares receptoras se realizaron de acuerdo con las instrucciones del fabricante (Thermo Fisher Scientific, Carlsbad, CA, EE. UU.). El reactivo de transfección polietilenimina (PEI) se adquirió de Sigma-Aldrich. Estable Vector-MCF10A, PRMT7-WT-MCF10A, PRMT7-R531K-MCF10A, Vector-MCF7, PRMT7-WT-MCF7, PRMT7-R531K-MCF7, PRMT7-WT-sobreexpresión de PRMT7knockout (KO) -MDA Las líneas celulares PRMT7-KO-MDA-MB-231 que sobreexpresan PRMT7-R531K se generaron mediante infección por lentivirus.

Extracción de ARN, transcripción inversa y RT-PCR en tiempo real

El ARN total se preparó con el kit de reactivos Trizol (TaKaRa, Dalian, China) de acuerdo con las instrucciones del fabricante. El ADNc se generó con cebadores aleatorios utilizando el Sistema de Transcripción Inversa (ambos de Promega, Madison, WI, EE. UU.). La PCR en tiempo real se realizó utilizando SYBR Green Realtime PCR Master Mix (CWBiotech, Beijing, China) que opera en un sistema de PCR en tiempo real LightCycler 480 (Roche, Basilea, Suiza). Las secuencias de los cebadores fueron las siguientes (directa e inversa, respectivamente): β-actina: 59-GAGCACAGAGCCTCGCCTTT-39 y 59-ATCCTTCTGACC-CATGCCCA-39 PRMT7: 59-GCCTATGGCTGATGCTGC −39 y 59- TCGGTGGAATGCTTGT -TGATin −39 GACAAC-AAGCCCGAATT-39 y 59-GGAAACTCTCTCGGTCCA-39 N-cadherina: 59-CGGGTAATCCTCCCAAATCA-39 y 59-CTTTA-TCCCGGCGTTTCATC-39 vimentina: 59-GAGAACTTTGCCGTT-GAGCGT-39 y GAGAACTTTGCCGTT-GAGCGT-39 y GAGAACTTTGCCGTT-GAGCGC-39 39 y 59-TCCCTCGGAACATCAGAAAC-39.

Inmunoprecipitación e inmunotransferencia

Las células se recolectaron y lisaron en tampón A [Tris-HCl 20 mM (pH 8,0), NaCl 10 mM, EDTA 1 mM y NP-40 al 0,5%] más una tableta de cóctel inhibidor de proteasa (Roche Diagnostics, Indianapolis, IN, EE. UU.) durante 30 min a 4 ° C. Los lisados ​​de proteína total se incubaron durante la noche con los anticuerpos correspondientes con agitación suave a 4 ° C, seguido de la adición de 40 μl de perlas magnéticas de mezcla de proteína A / G de proteoma pura (EMD-Millipore, Billerica, MA, EE. UU.) Durante 1 ha temperatura ambiente . Las perlas se lavaron 3 veces con Tampón A, se resuspendieron en 40 µl de tampón de carga 2x y se hirvieron durante otros 8 min. El sobrenadante se sometió a SDS-PAGE, se transfirió a PVDF (EMD-Millipore) y se detectó mediante reactivos ECL (GE Healthcare, Buckinghamshire, Reino Unido).

Purificación por afinidad de proteína marcada con Flag

Se transfectaron células HEK-293T con plásmido pWPXLD-3 ∗ flagPRMT7 WT o R531K, usando el reactivo PEI de acuerdo con las instrucciones del fabricante. Después de la transfección durante 48 h, las células se recolectaron y lisaron en el tampón A que contenía una tableta de cóctel inhibidor de proteasa (Roche). Los extractos celulares totales se incubaron con gel de afinidad anti-Flag (Biotool, Kirchberg, Suiza) durante 3 ha 4 ° C, y los inmunoprecipitados se lavaron 3 veces con tampón salino tamponado con Tris 1x [Tris-HCl 50 mM (pH 7,4 ) y NaCl 150 mM). Finalmente, las proteínas unidas se eluyeron con péptido bandera 3 ∗ (ApexBio, Houston, TX, EE. UU.) Durante 1 ha 4ºC.

Ensayo de metilación in vitro y análisis de espectrometría de masas

Se incubó pWPXLD-3 ∗ flag-PRMT7 WT / R531K (5 μg), ya sea solo o con histonas centrales (2 μg) en presencia de 3 H-S-adenosil-metionina (3 H-SAM 15 Ci / mmol PerkinElmer, Waltham, MA, EE.UU.) a 30 ° C durante 1 h. La reacción se detuvo añadiendo 5 x tampón de carga seguido de SDS-PAGE, luego se secó el gel y se autorradiografió a -80ºC.

La proteína 3 flag-PRMT7 se purificó a partir de células 3 ∗ flag-PRMT7-MCF10A y luego se resolvió mediante SDS-PAGE al 10%. Después de la tinción con azul brillante de Coomassie, se cortó la banda correspondiente a 3 ∗ flag-PRMT7 para análisis de cromatografía líquida-espectrometría de masas en tándem (LC-MS / MS) realizado en el Instituto de Biofísica (Academia de Ciencias de China, Beijing, China).

Ensayo de reducción de GST

pGEX-6P-1, pGEX-6P-1-PRMT7-WT y sus mutantes se expresaron en bacterias (BL21) inducidas con isopropil-β-Dtio-galactósido (IPTG) 0,1 mM durante 6 ha 25 ° C, y el se purificaron las proteínas (16).

Ensayos de extracción de péptidos

Los péptidos biotinilados N-terminales no metilados y monometilados que contienen 19 aa de PRMT7 humano, BiotinRDLWRIRSPCGDCEGFDV y Biotin-RDLWRIR (me1) SPCGDCEGFDV, fueron sintetizados por GL Biochem Ltd. (Shanghai, China) y purificados por HPLC. Los productos finales alcanzaron una pureza del 95% y se confirmaron mediante ionización por electropulverización-EM (ESI-MS).

El ensayo de extracción de péptidos se realizó como se describe en Sampath et al. ( 17 ).

Generación de anticuerpos para la monometilación de PRMT7 R531

El anticuerpo de monometilación PRMT7 R531 (PRMT7 R531me1) que abarca el péptido RDLWRIR (me1) SPCGDCEGFDV, que corresponde al aa 524-542 de la proteína PRMT7 humana, se usó para inmunizar conejos para generar un anticuerpo policlonal que detectara la monometilación PRMT7 R531. Se utilizó el kit de inmovilización para péptidos SulfoLink (ThermoFisher Scientific) para purificar el anticuerpo.

Ensayos de cicatrización de heridas, migración transwell e invasión

Estos experimentos se realizaron esencialmente como se describe en Hou et al. ( 18 ).

Ensayo indicador de luciferasa

Los experimentos se realizaron como se ha descrito en Liu et al. (19). El plásmido del gen indicador pGL4.20-E-cadherina (-420 / + 32) se construyó insertando los productos de amplificación por PCR del genoma humano.

Inmunoprecipitación de cromatina

El protocolo de inmunoprecipitación de cromatina (ChIP) se ha descrito en Wang et al. (20). Los cebadores para el promotor de E-cadherina fueron 59-TGGTGGTGTGCACCTGTACT-39 y 59-GACCTGCACGGTTCTGATTC-39.

Ensayo de metástasis pulmonar de ratón in vivo

Se inyectaron células estables Vector-MCF7, PRMT7-WT-MCF7 y PRMT7-R531K-MCF7 (2 x 10 6) en las venas de la cola de ratones desnudos hembra BALB / c de 5 semanas de edad. Un mes después, se inyectaron a los ratones 150 mg / kg de D-luciferina, i.p. (GoldBio, St. Louis, MO, EE. UU.) Para obtener imágenes de bioluminiscencia. Todos los experimentos con animales fueron aprobados por el Comité de Cuidado Animal de la Northeast Normal University.

Muestras de cáncer de mama humano e inmunohistoquímica

Se adquirieron micromatrices de muestras de tejido de cáncer de mama humano de Outdo Biotech (Shanghai, China). Los microarrays utilizados fueron HBre-Duc068Bch-01, HBreD090Bc01 y HBreD145Su02. Se realizaron procedimientos estándar de inmunohistoquímica (21).

Análisis estadístico

Los datos se presentan como medias ± DE. La significancia estadística fue probada por Student de 2 colas t pruebas con PAG & lt 0.05 indica significancia. El análisis estadístico se realizó con el software Prism (GraphPad Software, La Jolla, CA, EE. UU.) E Image-Pro Plus, ver. 6.0 (Media Cybernetics, Rockville, MD, EE. UU.).

R531 en PRMT7 fue metilado. A) In vitro ensayos de metilación. Se incubó la proteína 3 fl ag-PRMT7 purificada a partir de células HEK-293T, con o sin histonas centrales, en presencia de 3 H-SAM, y luego las reacciones se separaron mediante SDS-PAGE. Las proteínas metiladas se revelaron mediante autorradiografía y las proteínas totales se visualizaron mediante tinción con azul brillante de Coomassie. Flechas: PRMT7 puntas de flecha: histonas centrales. B) Purificación por afinidad de PRMT7. Se utilizaron células PRMT7-WT-MCF10A y VectorMCF10A para purificar la proteína PRMT7 etiquetada con Flag mediante un gel de afinidad anti-Flag. Los eluidos se separaron mediante SDS-PAGE y se visualizaron mediante tinción con azul brillante de Coomassie. Flechas: PRMT7. C) Análisis espectrométrico de masas. El PRMT7 purificado de las células MCF10A se analizó para en vivo metilación. Se identificó un residuo metilado de R531 en la fragmentación PRMT7 de IR # SPCGDCEGFDVHIMDDMIK. D) Alineaciones de secuencias de proteínas PRMT7 entre mamíferos. El residuo en la posición R531 de H. sapiens se indica arriba y se resalta en rojo en las secuencias de proteínas.


¿Qué significan ΔC y ΔN con respecto a una secuencia de proteínas? - biología

La señalización Wnt juega un papel crucial en la dirección de la diferenciación celular, la polaridad y el crecimiento 1, 2, 3. En la vía canónica, los receptores Wnt activan Disheveled (Dvl), que luego bloquea la degradación de un transductor de señal clave, la β-catenina, que conduce a la acumulación nuclear de β-catenina y la inducción de genes diana Wnt a través de factores de transcripción de la familia TCF / LEF 1, 2, 3. Aquí identificamos un nuevo gen de pez cebra que codifica Ccd1, que posee un dominio DIX (Di shevelled-A x in) . Los dominios DIX son esenciales para la transducción de señales de dos principales mediadores aguas abajo de Wnt, Dvl y Axin. Ccd1 formó complejos homoméricos y heteroméricos con Dvl y Axin y activó la transcripción dependiente de TCF in vitro. Además, la sobreexpresión de ccd1 en embriones de pez cebra condujo a una reducción en el tamaño de los ojos y el prosencéfalo (posteriorización), como se ve con wnt8 sobreexpresión 4, 5, 6, mientras que una dominante negativa ccd1 (DN-ccd1) causó el fenotipo opuesto. Además, el fenotipo de activación de Wnt inducido por ccd1 fue inhibida por la expresión de axin1 o DN-ccd1, y el wnt8 fenotipo de sobreexpresión fue rescatado por DN-ccd1, lo que sugiere que Ccd1 funciona corriente abajo del receptor Wnt y corriente arriba de Axin. Estos resultados indican que Ccd1 es un regulador positivo novedoso en esta vía de señalización Wnt durante el patrón neural del pez cebra.


Datos extendidos Figura 1 Interacciones en el sitio de unión al ligando ortostérico de BRIL-δOR (ΔN / ΔC) -naltrindol.

a, Vista de "primer plano" de la red de interacción de enlaces de hidrógeno (líneas de puntos amarillas) entre el ligando naltrindol (barras naranjas) y el receptor (cadenas laterales de dibujos animados verdes mostradas como barras) que muestran interacciones mediadas por agua (esferas rojas). B, Resumen de las interacciones mediadas por agua (líneas de puntos grises) en el bolsillo ortostérico de BRIL – δOR (ΔN / ΔC) –naltrindol. C, mFoDFC "Omitir" mapa de densidad de electrones (malla azul) alrededor del naltrindol (palos de naranja) después de un recocido simulado en PHENIX 41 (5000 K contorneado a 3σ) se muestran todas las moléculas de agua que rodean al ligando en el sitio ortostérico (esferas rojas). D, Representación de la superficie del BRIL – δOR (ΔN / ΔC) –naltrindol (superficie verde) que muestra la posición del naltrindol (palos de naranja) y el grupo de agua (esferas rojas) en el sitio ortostérico.

Datos extendidos Figura 2 Superposición de M. musculus y estructuras de receptores δ-OR humanos.

a, Comparación de la estructura BRIL-δOR (ΔN / ΔC) -naltrindol humana (verde) con la estructura cristalina de 3,4 Å previamente determinada de la M. musculus δOR-T4L (magenta PDB 4EJ4). El ligando naltrindol en la estructura BRIL-δOR (ΔN / ΔC) -naltrindol se muestra como esferas de color naranja y se omite en la estructura 4EJ4. Las moléculas de agua y el ion sodio en el sitio alostérico de la estructura BRIL-δOR (ΔN / ΔC) -naltrindol se muestran como esferas rojas y azules, respectivamente. El cuadro gris representa las regiones aproximadas del dominio del receptor 7TM incrustado en las barras amarillas de bicapa lipídica que representan los lípidos. Se omiten la proteína de fusión ICL3 en 4EJ4 (T4L) y la proteína de fusión BRIL N-terminal en las estructuras BRIL-δOR (ΔN / ΔC) -naltrindol. B, Conformación ECL3 de δ-OR humano y comparación con la estructura ECL3 de δOR-T4L de ratón. BRIL – δOR (ΔN / ΔC) –naltrindol se muestra como una caricatura verde y las cadenas laterales se representan como palos verdes. El ligando naltrindol está representado por barras de carbono naranja y esferas transparentes (estructura BRIL-δOR (ΔN / ΔC) -naltrindol) y barras de carbono magenta (estructura 4EJ4).

Datos extendidos Figura 3 Conservación de la bolsa alostérica en los GPCR de clase A que albergan un ion sodio y un grupo de agua.

a, Structural comparison of the sodium pocket between BRIL–δOR(ΔN/ΔC)–naltrindole structure (green cartoon and carbon atoms) and sodium-bound 1.8 Å resolution structure of A2AAR (PDB 4EIY yellow cartoon and carbons). Water molecules of the pocket in the δ-OR structure are shown by red transparent spheres and smaller solid spheres, whereas water molecules in the A2AAR structure pocket are shown with small yellow solid spheres only. Sodium ions in both structures are shown with blue transparent spheres, with red dotted lines from the Na + ion to the five coordinating oxygen atoms shown in the δ-OR structure. Part of the ligand naltrindole is shown as thick sticks with orange carbons. The comparison reveals identical side chains and similar conformations in 15 residue positions of the pocket. The important exception is the 3.35 position that in δ-OR features a polar Asn 131 3.35 side chain coordinating the Na + ion, whereas in A2AAR the Leu 87 3.35 side chain is oriented towards the lipidic membrane. B, Sequence comparison of the allosteric sodium pocket residues in currently available crystal structures of class A GPCRs. Asterisk marks receptors with high-resolution crystallographic evidence for sodium ions coordinated by the D 2.50 side chain. Note that rhodopsin (OPSD) lacks polar residues in key positions 3.39, 7.45 and 7.46, which sets it apart from other class A receptors.

Extended Data Figure 4 Electron density maps around the δ-OR sodium-binding site.

a, 2mFoDFC electron density map (grey mesh) of receptor residues (cyan sticks) around the sodium ion (blue sphere)-binding site contoured at 1σ. Black dashed lines represent interactions between the sodium ion and the atoms in direct contact with the receptor residues or water molecules in the first hydration shell of the ion. Yellow dashed lines show the hydrogen-bond network of water molecules and receptor residues. These polar interactions in the core of the 7TM bundle of the receptor establish an axis of connectivity between the orthosteric binding site, allosteric sodium site and residues in the intracellular side of the receptor. B, mFoDFC ‘omit’ electron density map of sodium ion and coordinating water molecules after simulated annealing in PHENIX 41 (5,000 K contoured at 3σ).

Extended Data Figure 5 Functional characterization of wild-type δ-OR and the engineered BRIL–δOR(ΔN/ΔC) construct used for crystallization.

a, B, G-protein signalling characterization for wild-type (a) and BRIL–δOR(ΔN/ΔC) (B) is shown. Allosteric inhibitory effect of sodium on DADLE binding to 3 H-naltrindole-labelled wild-type δ-OR expressed in HEK293 cells (positive control) (C) and the BRIL–δOR(ΔN/ΔC) construct used for crystallization and expressed in Sf9 cells (D). Ligand-binding data (D) were analysed using the allosteric model, and the results are shown in Table 1. Data represent the mean of four independent experiments each in quadruplicate.


Ver el vídeo: Secuencias, enzimas y proteínas implicados en la replicación (Mayo 2022).