Información

16.12: Clonación - Biología

16.12: Clonación - Biología


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Clonación molecular

En general, la palabra "clonación" significa la creación de una réplica perfecta; sin embargo, en biología, la recreación de un organismo completo se conoce como "clonación reproductiva". Mucho antes de que se hicieran intentos de clonar un organismo completo, los investigadores aprendieron cómo reproducir regiones deseadas o fragmentos del genoma, un proceso que se conoce como clonación molecular.

La clonación de pequeños fragmentos del genoma permite la manipulación y el estudio de genes específicos (y sus productos proteicos) o regiones no codificantes de forma aislada. Un plásmido (también llamado vector) es una pequeña molécula de ADN circular que se replica independientemente del ADN cromosómico de microorganismos como E. coli. En la clonación, las moléculas de plásmido se pueden usar para proporcionar una "carpeta" en la que insertar un fragmento de ADN deseado. Los plásmidos generalmente se introducen en un huésped bacteriano para su proliferación. En el contexto bacteriano, el fragmento de ADN del genoma humano (o el genoma de otro organismo que se está estudiando) se denomina ADN extraño, o un transgén, para diferenciarlo del ADN de la bacteria, que se llama el ADN del anfitrión.

Los plásmidos se encuentran naturalmente en poblaciones bacterianas (como Escherichia coli) y tienen genes que pueden aportar rasgos favorables al organismo, como Resistencia antibiótica (la capacidad de no verse afectado por los antibióticos). Los plásmidos se han reutilizado y diseñado como vectores para la clonación molecular y la producción a gran escala de reactivos importantes, como la insulina y la hormona del crecimiento humana. Una característica importante de los vectores plasmídicos es la facilidad con la que se puede introducir un fragmento de ADN extraño a través del sitio de clonación múltiple (MCS). El MCS es una secuencia de ADN corta que contiene múltiples sitios que pueden cortarse con diferentes endonucleasas de restricción comúnmente disponibles. Endonucleasas de restricción reconocer secuencias de ADN específicas y cortarlas de una manera predecible; son producidos naturalmente por bacterias como mecanismo de defensa contra ADN extraño. Muchas endonucleasas de restricción hacen cortes escalonados en las dos hebras de ADN, de modo que los extremos cortados tienen un saliente monocatenario de 2 o 4 bases. Debido a que estos voladizos pueden recocerse con voladizos complementarios, se denominan "extremos pegajosos". La adición de una enzima llamada ADN ligasa une permanentemente los fragmentos de ADN a través de enlaces fosfodiéster. De esta forma, cualquier fragmento de ADN generado por la escisión de endonucleasa de restricción puede empalmarse entre los dos extremos de un ADN plasmídico que ha sido cortado con la misma endonucleasa de restricción (Figura 1).

Moléculas de ADN recombinante

Los plásmidos con ADN extraño insertado en ellos se denominan ADN recombinante moléculas porque se crean artificialmente y no ocurren en la naturaleza. También se denominan moléculas quiméricas porque el origen de diferentes partes de las moléculas se remonta a diferentes especies de organismos biológicos o incluso a la síntesis química. Las proteínas que se expresan a partir de moléculas de ADN recombinante se denominan proteínas recombinantes. No todos los plásmidos recombinantes son capaces de expresar genes. Es posible que sea necesario mover el ADN recombinante a un vector (o huésped) diferente que esté mejor diseñado para la expresión génica. Los plásmidos también pueden diseñarse para expresar proteínas solo cuando son estimulados por ciertos factores ambientales, de modo que los científicos puedan controlar la expresión de las proteínas recombinantes.

Vea una animación de la recombinación en la clonación desde el Centro de aprendizaje de ADN.

Clonación celular

Los organismos unicelulares, como las bacterias y las levaduras, producen de forma natural clones de sí mismos cuando se replican asexualmente por fisión binaria; esto se conoce como clonación celular. El ADN nuclear se duplica mediante el proceso de mitosis, que crea una réplica exacta del material genético.

Pregunta de práctica

Está trabajando en un laboratorio de biología molecular y, sin que usted lo sepa, su compañero de laboratorio dejó el ADN genómico extraño que planea clonar en la mesa del laboratorio durante la noche en lugar de almacenarlo en el congelador. Como resultado, fue degradado por nucleasas, pero aún se usó en el experimento. El plásmido, por otro lado, está bien. ¿Qué resultados esperaría de su experimento de clonación molecular?

  1. No habrá colonias en la placa bacteriana.
  2. Solo habrá colonias azules.
  3. Habrá colonias azules y blancas.
  4. Solo serán colonias blancas.

[revelar-respuesta q = ”511969 ″]Mostrar respuesta[/ revelar-respuesta]
[respuesta oculta a = ”511969 ″] Respuesta b. El experimento daría como resultado colonias azules solamente. [/ Hidden-answer]

La clonación reproductiva

La clonación reproductiva es un método utilizado para hacer un clon o una copia idéntica de un organismo multicelular completo. La mayoría de los organismos multicelulares se reproducen por medios sexuales, lo que implica la hibridación genética de dos individuos (padres), lo que hace imposible la generación de una copia idéntica o un clon de cualquiera de los padres. Los recientes avances en biotecnología han hecho posible inducir artificialmente la reproducción asexual de mamíferos en el laboratorio.

La partenogénesis, o "nacimiento virginal", ocurre cuando un embrión crece y se desarrolla sin que ocurra la fertilización del óvulo; esta es una forma de reproducción asexual. Un ejemplo de partenogénesis ocurre en especies en las que la hembra pone un óvulo y si el óvulo es fecundado, es un óvulo diploide y el individuo se convierte en hembra; si el óvulo no se fertiliza, sigue siendo un óvulo haploide y se convierte en macho. El huevo no fertilizado se llama huevo partenogénico o virgen. Algunos insectos y reptiles ponen huevos partenogénicos que pueden convertirse en adultos.

La reproducción sexual requiere dos células; cuando el óvulo haploide y los espermatozoides se fusionan, se produce un cigoto diploide. El núcleo del cigoto contiene la información genética para producir un nuevo individuo. Sin embargo, el desarrollo embrionario temprano requiere el material citoplasmático contenido en el óvulo. Esta idea forma la base de la clonación reproductiva. Por lo tanto, si el núcleo haploide de un óvulo se reemplaza con un núcleo diploide de la célula de cualquier individuo de la misma especie (llamado donante), se convertirá en un cigoto genéticamente idéntico al donante. La transferencia nuclear de células somáticas es la técnica de transferir un núcleo diploide a un huevo enucleado. Puede utilizarse para la clonación terapéutica o la clonación reproductiva.

El primer animal clonado fue Dolly, una oveja que nació en 1996. La tasa de éxito de la clonación reproductiva en ese momento era muy baja. Dolly vivió siete años y murió por complicaciones respiratorias (Figura 2). Se especula que debido a que el ADN celular pertenece a un individuo mayor, la edad del ADN puede afectar la esperanza de vida de un individuo clonado. Desde Dolly, se han clonado con éxito varios animales como caballos, toros y cabras, aunque estos individuos a menudo presentan anomalías faciales, de extremidades y cardíacas. Ha habido intentos de producir embriones humanos clonados como fuentes de células madre embrionarias, lo que a veces se denomina clonación con fines terapéuticos. La clonación terapéutica produce células madre para intentar remediar enfermedades o defectos perjudiciales (a diferencia de la clonación reproductiva, que tiene como objetivo reproducir un organismo). Aún así, los esfuerzos de clonación terapéutica han encontrado resistencia debido a consideraciones bioéticas.

Pregunta de práctica

¿Crees que Dolly era una oveja Finn-Dorset o una oveja escocesa Blackface?

[filas del área de práctica = ”2 ″] [/ área de práctica]
[revelar-respuesta q = ”985505 ″]Mostrar respuesta[/ revelar-respuesta]
[hidden-answer a = ”985505 ″] Dolly era una oveja de Finn-Dorset porque aunque la célula original provenía de una oveja escocesa de cara negra y la madre sustituta era una escocesa de cara negra, el ADN provenía de una finlandesa de Dorset. [/ hidden -respuesta]


Un sistema libre de células bioinspirado para la producción de cannabinoides a partir de insumos económicos

Mover la producción de cannabinoides lejos de los caprichos de la extracción de plantas y convertirla en microbios modificados podría proporcionar una fuente constante, más pura, más barata y ambientalmente benigna de estas importantes moléculas terapéuticas, pero la producción microbiana enfrenta desafíos notables. Una alternativa a los microbios y las plantas es eliminar la complejidad de los sistemas celulares mediante el empleo de la biosíntesis enzimática. Aquí diseñamos e implementamos un nuevo sistema sin células para la producción de cannabinoides con las siguientes características: (1) solo se necesitan insumos de bajo costo (2) solo se emplean 12 enzimas (3) el sistema no requiere oxígeno y (4) Utilizamos un sistema enzimático no natural para reducir los requisitos de ATP que generalmente se aplica a las vías dependientes de malonil-CoA, como la biosíntesis de policétidos. El sistema produce

0,5 g l −1 de ácido cannabigerólico (CBGA) o ácido cannabigerovarínico (CBGVA) de insumos de bajo costo, casi dos órdenes de magnitud más que la producción a base de levadura. Los sistemas sin células como este pueden proporcionar una nueva ruta hacia la producción confiable de cannabinoides.


MATERIALES Y MÉTODOS

Amplificación por PCR para el aislamiento inicial del ADN genómico del nuevo receptor. El cebador directo (OPS3: CATAGCCCTCGACCGGTACT) codifica el extremo citoplásmico del tercer dominio transmembrana delDrosophila receptor de octopamina / tiramina (OctyR99AB) (Arakawa et al., 1990). El cebador inverso (OPS4: GGCAGCCAGCAGATGACGAA) codifica la región media del dominio transmembrana VI de este receptor. La plantilla de PCR fue de 300 ng de Drosophila ADN genómico preparado a partir de moscas adultas Canton-S de tipo salvaje (Jowett, 1986). La mezcla de PCR de 100 μl contenía 0,2 m m cada uno de desoxirribonucleótido trifosfato, tampón Tris-HCl 10 m m, pH 8,3, KCl 50 m m, MgCl 1,5 m m2, 0.001% de gelatina, 0.1 μ m de cada cebador y 2.5 unidades de ADN polimerasa AmpliTaq (Perkin-Elmer, Norwalk, CT). La PCR se realizó en condiciones de recocido de rigurosidad reducida: 94 ° C durante 2 min, 33 ° C durante 2 min, 72 ° C durante 2 min durante 6 ciclos seguidos de 31 ciclos adicionales con una temperatura de recocido de 42 ° C en lugar de 33 ° C. La extensión final fue de 10 min a 72 ° C. Los productos de la PCR se analizaron mediante electroforesis de 10 µl de mezcla de reacción en un gel de agarosa al 1%.

Secuencia ADN. La secuenciación directa del producto de PCR se realizó como se describió anteriormente (Feng et al., 1995 Zheng et al., 1995) usando un Taq Kit de secuenciación de ciclo de imprimación de tinte (Applied Biosystems, Foster City, CA). Para facilitar la secuenciación del clon de cDNA, se utilizaron deleciones anidadas (Henikoff, 1987). Cada segmento de ADN se secuenció al menos dos veces en ambas direcciones. El contig se ensambló utilizando el software Geneworks (Intelligenetics, Mountain View, CA).

Detección de clones de ADNc. El fragmento de 0,68 kb del experimento de amplificación por PCR inicial se marcó con [α-32 P] dCTP (∼110 TBq / mmol) utilizando el sistema de etiquetado de ADN Multiprime (Amersham, Arlington Heights, IL) y se utilizó para cribar un Drosophila biblioteca de cDNA head (Itoh et al., 1985) en λgt11, generosamente proporcionada por el Dr. Paul Salvaterra (Beckman Research Institute, Duarte, CA). Se identificaron cuatro clones positivos mediante selección de alta rigurosidad (Sambrook et al., 1989) de 4 x 105 unidades formadoras de placa (ufp). El inserto más largo (4 kb) se cortó con EcoRI y se subclonó en pBluescript II SK (-) para un análisis adicional. Este inserto y el gen que lo codifica se denominan DopR99B en este documento.

Transferencias del norte. Se aislaron cabezas, cuerpos y apéndices (patas y antenas) de moscas adultas congeladas (Schmidt-Nielsen et al., 1977). Se prepararon poli (A) + ARN y transferencias como se describió previamente (Feng et al., 1995 Zheng et al., 1995). Se corrió poli (A) + ARN (10 µg / carril) en un gel desnaturalizante de formaldehído agarosa (0,8%). Las transferencias se sondaron con el fragmento de PCR de 0,68 kb marcado con 32P añadido a una concentración final de 106 cpm / ml. Después de un lavado muy riguroso (Feng et al., 1995 Zheng et al., 1995), las transferencias se expusieron a una película de rayos X durante 24 horas a -70 ° C.

En el lugar hibridación con aplastamientos cromosómicos de glándulas salivales.El fragmento de PCR de 0,68 kb se biotiniló, se hibridó con aplastamientos de cromosomas politenos de glándulas salivales larvarias y se localizó utilizando el kit de detección Bluegene de Gibco (Gaithersburg, MD) como describen Engels et al. (1985) con modificaciones menores (Feng et al., 1995 Zheng et al., 1995).

Expresión en Xenopus ovocitos. Se preparó el ARNc de sentido in vitro del clon DopR99B en el vector pBluescript II SK (-) usando T7 ARN polimerasa (Stratagene, La Jolla, CA) después de linealizar el plásmido con NoYo (Promega, Madison, WI). Las transcripciones se taparon añadiendo 0,75 unidades de m 7 G (5 ') ppp (5') G (Boehringer Mannheim, Indianapolis, IN) a una reacción de transcripción estándar de 150 µl (kit Stratagene).

Ovocitos en estadio V y VI de hembras adultas vírgenes Xenopus laevis se separaron manualmente y se colocaron en medio ND96 estéril [en m m: NaCl 96, KCl 2, CaCl2 1,8, MgCl2 1, tampón HEPES (pH 7,6) 5, que contiene 2,4 m m de piruvato de sodio, 100 U / ml de penicilina, 0,1 mg / ml de estreptomicina, 0,2 mg / ml de gentamicina]. Los ovocitos se desfolicularon enzimáticamente mediante incubación en colagenasa que contenía ND96 (2 mg / ml) durante 30 min. A continuación, se inyectaron a los ovocitos 50 ng de Drosophila ARNc sentido del receptor DopR99B y se incuba a 19 ° C durante 2 a 5 días. Se utilizaron ovocitos no inyectados como controles.

Se realizaron registros electrofisiológicos de ovocitos utilizando una técnica de sujeción de voltaje de dos microelectrodos, a un potencial de retención de -60 mV, para medir las corrientes de ovocitos (Van Renterghem et al., 1987). Los ovocitos se superfundieron continuamente con ND96 durante los experimentos a temperatura ambiente y se añadieron fármacos al superfundido.

Ensayos de AMPc. Para controlar los niveles de AMPc, se preincubaron ovocitos individuales durante 30 min en ND96 más 100 μm de isobutilmetilxantina (IBMX). Los ovocitos experimentales se incubaron durante 30 min más con la concentración deseada de agonista en el mismo medio mientras que los ovocitos de control (para medir los niveles basales de AMPc) se incubaron en paralelo en el mismo medio sin agonista. Después de las incubaciones, cada ovocito se homogeneizó en 500 µl de etanol acidificado, se centrifugó para eliminar el material particulado y el sobrenadante se evaporó hasta sequedad en una centrífuga de vacío (Savant, Farmingdale, NY). Cada muestra se recogió en 60 µl de tampón de ensayo y se analizó para cAMP utilizando un kit de ensayo comercial (Amersham).

Drogas. Los fármacos utilizados en la clasificación del receptor expresado se obtuvieron de las siguientes fuentes: clorhidrato de dopamina, (-) - clorhidrato de norepinefrina, (-) - epinefrina, clorhidrato de tiramina, clorhidrato de dl -octopamina, clorhidrato de 5-hidroxitriptamina, (±) - clorhidrato de isoproterenol, clorhidrato de fentolamina y dl -propranolol eran de Sigma (Poole, Dorset, Reino Unido) R(+) - SKF-38393 [R(+) - 1-fenil-2,3,4,5-tetrahidro- (1H) -3-benzazepina-7,8-diol], quineloranoodihidrocloruro, (-) - clorhidrato de quinpirol, PD-128,907 [(+) - (4aR, 10bR) -3,4,4a, 10b-tetrahidro4-propil-2H, 5H- (1) benzopirano- (4,3-b) -1,4-oxazin-9-ol-hidrocloruro],cis- diclorhidrato de (Z) -flupentixol,R(+) SCH-23390 [RClorhidrato de (+) - 7cloro-8-hidroxi-3-metil-1-fenil-2,3,4,5-tetrahidro-1H-3-benzepina], S (-) - sulpirida, clorhidrato de espiperona, (+) - clorhidrato de butaclamol, clorhidrato de S (-) - eticloprida, domperidona, (+) - metanosulfonato de bromocriptina, (±) -6-cloro-APB [(±) -6-cloro-7,8-dihidroxi-3-alil-1- bromhidrato de fenil-2,3,4,5-tetrahidro-1H-3benzazepina], R(+) - 6-bromo-APB (R(+) - 6-bromo7,8-dihidroxi-3-alil-1-fenil-2,3,4,5-tetrahidro-1H-3-benzazepina hidrobromuro), (±) -6-cloro-PB [ Bromhidrato de (±) -6-cloro-7,8-dihidroxi-1-fenil-2,3,4,5-tetrahidro-1H-3-benzazepina] y (±) -PPHT [(±) -2- (norte-feniletilo-nortehidrocloruro de -propil) amino-5-hidroxitetralina] eran de Research Biochemicals (Natick, MA).


2 respuestas 2

Trabajé durante mucho tiempo en una empresa líder en anticuerpos de alta calidad, así que intentaré compartir algunas de mis experiencias con ustedes. El proceso de fabricación de un anticuerpo altamente específico (me centraré en los monoclonales) tiene tres partes importantes: diseño e inmunización de antígenos, clonación y subclonación, y detección / validación. Cada parte es crucial por sí sola, y cuanto mejor se realice, mayores serán sus posibilidades de éxito en la fase posterior.

Para que un anticuerpo funcione, debe unirse específicamente a su objetivo. No entraré en todos los detalles aquí, ya que hay una buena literatura abierta sobre el diseño de antígenos, pero básicamente necesita algo que promueva una fuerte respuesta inmune en el huésped, le brinde una variedad de clones para elegir y sea específico: no debe unirse a otros objetivos además de la proteína de interés. Hay muchos factores a considerar, incluida la antigenicidad, la solubilidad, la facilidad de producción (para inmunización y detección), consideraciones estéricas (¿otra proteína o ácido nucleico oscurece el sitio objetivo en vivo?), y otros. Los antígenos se pueden dividir aproximadamente en dos tipos: péptidos (generalmente menos de 20 o 30 aminoácidos) y proteínas o fragmentos de proteínas. Lo más probable es que desee probar varios antígenos para maximizar sus probabilidades de éxito. Una vez que se sintetiza y purifica el antígeno, debe elaborar un programa de inmunización para preparar y estimular a los animales, luego determinar cuándo y cómo probarlos (detección), y a qué hora y cómo recolectarlos para el proceso monoclonal.

Luego viene el proceso de clonación. Los clones se pueden generar mediante una variedad de métodos, algunos ampliamente disponibles, como los diversos métodos de hibridomas, y algunos son propiedad de empresas individuales. Mi antigua empresa empleaba una combinación de ambos, dependiendo de la especie de animal, utilizando una tecnología interna realmente genial que se mejoraba y ampliaba constantemente. Estos procesos dependen en gran medida de la calidad de los materiales que se utilizan y de la experiencia de los clonadores. Las células B de entrada (que producen los anticuerpos) deben haber sido recolectadas, tratadas y almacenadas de acuerdo con un conjunto de pasos precisos para permitir el mayor número de clones viables. Una vez que se han obtenido las células inmortalizadas (después de la fusión con las células compañeras de mieloma en el proceso de hibridoma, por ejemplo), se diluyen hasta un recuento de células predeterminado y se colocan en placas de 96 pocillos y se dejan recuperar y crecer durante un tiempo. durante el cual secretan anticuerpos al medio. Luego, este medio se prueba rápidamente (antes de que las células crezcan demasiado en el pocillo), y los pocillos positivos se diluyen en (con suerte) suspensiones unicelulares y se subclonan, o se congelan para más tarde. La primera prueba con frecuencia se realiza mediante ELISA con el antígeno inmunizante, aunque, según la aplicación de interés, puede ser mediante detección de alto rendimiento mediante citometría de flujo, inmunohistoquímica o inmunofluorescencia. Después de la prueba inicial, los pasos posteriores de subclonación y nueva prueba pueden ocurrir a un ritmo más mesurado, ya que las células pueden congelarse indefinidamente después de generar cantidades suficientes de anticuerpos en el sobrenadante.

Aquí es donde entra en juego la calidad de su programa de detección. Sus ensayos deben estar bien diseñados, ser sólidos, estar bien documentados y realizarse, y tener controles positivos y negativos apropiados para que pueda saber realmente si un determinado clon es de interés. o funciona mejor que un producto existente. Esto significa condiciones controladas, reactivos y protocolos estandarizados y un alto grado de repetibilidad de un ensayo a otro. Además, no se puede enfatizar lo suficiente la idoneidad de sus controles. ¿Tiene una muestra knockout o sin expresión para comparar, o una forma de ver la línea de base frente a la actividad inducida o inhibida? Para ChIP, a menos que tenga un buen anticuerpo de control y un par de cebadores para su gen de interés, ¿cómo sabrá si el ensayo funciona? Puede obtener un gran resultado si realiza una inmunoprecipitación directa-Western blot, pero aún así no derriba la proteína unida al ADN. Si su método de ChIP no produce ADN limpio, es posible que nunca se adhiera. Y si no tiene los protocolos de análisis de datos adecuados con múltiples pozos replicados, puede perder el tiempo persiguiendo ruido en lugar de una señal específica. Además, además de probar todos sus clones, también debe valorarlos para determinar la concentración de trabajo óptima. He visto muchos anticuerpos que parecen una porquería cuando se prueba por primera vez el supe, pero diluidos 100 o 1000X son limpios, específicos y aún fuertes. Sea paciente, la prueba es mucho trabajo y requiere un montón de repetición para confirmar sus resultados, pero al final valdrá la pena.

Finalmente, después de hacer todo esto, es de esperar que tenga un gran clon que haga lo que quiere que haga, y mejor que cualquier otra cosa. Ahora debes decidir qué vas a hacer con él, porque si eres un laboratorio académico y publicas con él, el mundo llamará a tu puerta. No afloje al final y decida que 100 ml de sobrenadante serán suficientes para durar para siempre: guarde los clones y colóquelos en un banco de células, o intente llegar a un acuerdo de comercialización con una empresa de fabricación para que usted no tenga que hacerlo. haz todo el trabajo!

Espero que esto te ayude. Avísame si tienes más preguntas o inquietudes.


Discusión

El modular pOp6El sistema inducible por glucocorticoides / LhGR descrito aquí permite una inducción eficaz y robusta de la expresión del transgén en el arroz (Figs. 2, 5, 6, 7, 8). El sistema es muy sensible, responde a concentraciones nanomolares de DEX (Fig. 5) y es susceptible de diferentes métodos de aplicación de DEX para adaptarse a diferentes propósitos. Por ejemplo, los tejidos desprendidos (como en la Fig.2) podrían usarse para seleccionar líneas T0 en regeneración para la inducción efectiva de la expresión transgénica, los ensayos de inmersión (como en la Fig.8) podrían usarse para identificar objetivos / efectos inmediatos de la actividad génica inducida. , y el crecimiento en medio que contiene DEX 0,01 µM (como en la Fig. 5) podría usarse para analizar el efecto del gen inducido sobre el desarrollo de la raíz. Sin embargo, la inducción controlada de genes durante el desarrollo de los brotes será más desafiante, debido a que las concentraciones de DEX que se requieren para inducir la pOp6 promotor en el brote, inhibe el crecimiento cuando se incluye en el medio de cultivo (Figs. 3, 4 y Fig. 6). Aunque la inclusión de IPTG en el medio de cultivo mejora los efectos tóxicos de LhGR (Figuras 4 y 6), las concentraciones relativas de DEX frente a IPTG deberán calibrarse para cada línea transgénica para maximizar la expresión del transgén y minimizar los defectos de crecimiento. Es decir, para apagar la unión de LhGR inducida por DEX a LACO-como sitios en el genoma del arroz, al mismo tiempo que permite una unión eficiente al pOp6 promotor en el transgén. Fundamentalmente, se vio muy poca expresión en el pOp6 promotor en ausencia de inductor, lo que permitirá que los transgenes potencialmente letales sean transportados a través de la regeneración de plantas T0, asegurando una cosecha exitosa de la semilla transgénica T1.

Los severos defectos observados en el arroz. pOp6/ LhGR líneas transgénicas después del crecimiento en DEX 10 μM fueron inesperadas, porque no se informa que concentraciones similares del esteroide tengan un efecto en pOp6/ LhGR líneas de tabaco o Arabidopsis [5, 6]. De hecho, el pOp6/ El sistema LhGR se desarrolló por primera vez para superar el problema de que el sistema inducible por DEX existente, que utilizaba el activador transcripcional GVG con el afín GAL4 promotor [23], con frecuencia condujo a defectos de crecimiento en Arabidopsis, arroz y Lotus japonicus [8, 14, 15]. Aunque no se estableció la base molecular de estos defectos de crecimiento, se propuso que el activador de GVG se unía a elementos reguladores cis en el genoma de la planta que tenían homología de secuencia con GAL4 [15]. El activador de GVG comprende el dominio de unión al ADN del factor de transcripción GAL4 de levadura, el dominio de activación de la proteína viral del herpes VP16 y el mismo dominio GR que en LhGR [23]. El inhibidor de Gal80 posiblemente podría usarse para valorar la unión de GAL4 fuera del objetivo [24] de la misma manera que IPTG se usó aquí como un antagonista eficaz para la LacI Dominio de unión de ADN en LhGR (Figs.4, 6), pero el Gal80 el gen tendría que coexpresarse en planta y la actividad puede ser difícil de modular. los pOp6 /El sistema LhGR descrito aquí es, por lo tanto, actualmente la mejor opción para su uso en arroz, con la salvedad de que los efectos fenotípicos de la expresión génica inducida deben distinguirse de los efectos no específicos de LhGR, mediante la comparación con líneas de control que tienen niveles similares de expresión de LhGR pero ningún gen de interés aguas abajo de pOp6.

Debido a la estrategia de clonación modular Golden Gate que se utilizó para generar la pOp6/ LhGR informados aquí, existe la posibilidad de modificar fácilmente el sistema para una mayor optimización. Por ejemplo, se podrían inducir simultáneamente múltiples genes de interés con un único módulo de LhGR y / o se podrían añadir promotores específicos de tejido para controlar espacialmente la actividad de LhGR. En todos los casos, se debe tener cuidado al introducir intrones en las construcciones, ya que las secuencias reguladoras dentro de ellas pueden mejorar la expresión génica con y sin inducción [25]. Un enfoque alternativo sería generar un sistema sintético que sea ortogonal al genoma del arroz y, por lo tanto, no pueda verse comprometido por los efectos fuera del objetivo de la aplicación DEX. En un sistema sintético, los activadores transcripcionales como dTALEs [26] se diseñarían para unir secuencias promotoras únicas que no están presentes en el genoma del arroz, y el activador luego se fusionaría con la secuencia GR utilizada aquí. De hecho, este enfoque podría usarse para diseñar un sistema ortogonal para cualquier especie de elección.


Resultados

Cambio de isotipo CH1 de FabA mucoso en FabG

Para evaluar el papel del dominio CH1 en la especificidad y función de Ab mucoso, se estudiaron dos clones de FabA, a saber, 43 y 177. Estos FabA se obtuvieron previamente [3] mediante el cribado de una biblioteca HESN FabA en la región extendida proximal de la membrana de clado B gp41 (MPER) P1 [19,20] o en el clado B recombinante gp41 eliminado para su MPER [3], respectivamente. A nivel molecular, FabA 43 tiene un alto grado de mutaciones somáticas, un origen de la línea germinal de la cadena pesada VH3 similar al bNAb IgG 10E8 [21], y un CDRH3 largo de 22 residuos, características de otros bNAb IgG [3]. Por el contrario, FabA 177 tiene un bajo nivel de mutaciones somáticas en la cadena pesada, 100% de homología con la región del gen de la línea germinal IGKVID-30 * -01 y un CDRH3 de longitud normal de 11 residuos [3]. Además, la cadena pesada de FabA 177 se origina en la familia VH6, un origen de la línea germinal que nunca se asoció con las IgG de bNAb. Cada FabA se transformó en el FabG correspondiente mediante ingeniería genética, reemplazando el CH1α1 por un CH1γ1, y se purificó mediante cromatografía de afinidad, como se describe en la sección Material y métodos. En cada par, los isotipos comparten dominios VH y VL idénticos y la misma cadena ligera, diferenciándose únicamente por el dominio CH1.

Unión y afinidad de FabA y FabG por la envoltura del VIH-1

Primero evaluamos si el cambio de clase conserva las propiedades de unión originales de IgA comparando la unión de FabA y FabG con la gp41 trimérica recombinante derivada del clado B del VIH-1 [20] y la gp140 derivada de los clados A y C del VIH-1, los tres principales VIH -1 clados prevalentes en todo el mundo. Para evitar el sesgo introducido por los diferentes anticuerpos específicos de isotipo utilizados para la detección, se reveló la unión a gp41 en ELISA utilizando la cadena ligera kappa antihumana de ratón [12]. FabA 43 y 177 reconocen regiones conservadas conformacionalmente en el clado B gp41 de virus trópicos R5 y X4 [12]. Encontramos que los pares FabA y G se unen específicamente al clado B gp41 así como a los clados A y C gp140 de una manera dependiente de la dosis, pero sorprendentemente para todos los clados, la unión de FabA 43 y 177 es más eficiente en comparación con la de sus respectivo FabG (Fig. 1A y 1B). Por lo tanto, se requiere una concentración 50 veces mayor de FabG 43 (50 μg / ml) para alcanzar la misma unión de gp41 de clado B de FabA 43 (1 μg / ml) (Figura 1A). Las diferencias observadas entre FabA y G 177 son incluso mayores, llegando a 500 veces entre los isotipos a favor de FabA (Fig. 1B). De manera similar, la unión a una cantidad constante de clado A y C gp140, requirió 10 veces menos FabA 43 que FabG 43 (Figura 1A), y 50-100 veces menos FabA 177 que FabG 177 (Figura 1B), respectivamente. El Fab-IgA D1.3 específico para lisozima [3] y el Fab-IgG irrelevante utilizado como control negativo no reconocen ninguno de los clados B gp41 ni de los clados A y C gp140.

FabA y G de los clones 43 y 177 que se unen a los clados A, B y C de la gp41 de la envoltura del VIH de una manera dependiente de la dosis. A y B: La especificidad de FabA (línea continua) y FabG (línea de puntos) para el clado A gp140 (rojo), clado B gp41 (azul) clado C gp41 (verde) se evaluó mediante ELISA. Para la comparación directa de los isotipos FabA y G, la detección se realizó utilizando una cadena ligera anti-kappa. La unión específica (DO450 nm) se representa en función de la concentración de Fab (μg / ml). Los valores representan la media ± SEM, derivados de 3 experimentos independientes realizados por duplicado. (A) Fab 43, (B) Fab 177. C: La especificidad de FabA 43 (línea continua) y FabG 43 (línea de puntos) para el clado cruzado del péptido P1, a saber, clado A (rojo), clado B (azul) y clado C (verde) se evaluó mediante ELISA. Se muestra un representante de los tres experimentos independientes realizados por duplicado. D y E: Unión de FabA y G de los clones 43 y 177 a infectados por VIH-1 CD4 + Células T. FabA (barras sólidas) y FabG (barras sombreadas) de los clones 43 (D) y 177 (mi) se incubaron con células infectadas por VIH de clado A (rojo) o clado B (azul) y clado C (verde) o células no infectadas como control negativo durante la noche a 4 ° C. Se utilizaron IgA e IgG irrelevantes como controles negativos. La unión específica se detectó usando cadena ligera kappa antihumana conjugada con FITC para permitir la comparación directa de los isotipos FabA y G, y se analizó mediante citometría de flujo, como se indica en la sección Materiales y métodos. Los valores representan el% de Fab + ± SEM entre las células T CD4 + infectadas con VIH-1 (Gag-p24 +). La unión de todos los Fab a células no infectadas fue insignificante. La unión de IgA e IgG irrelevantes a las células infectadas se fijó al 1% y se restó de los valores de unión específicos n = 3 experimentos independientes. Prueba t de Student, * = p & lt0.05.

A continuación, se utilizó resonancia de plasmón de superficie (SPR) en experimentos cinéticos para comparar la afinidad de FabA y G con el clado B gp41, clado A o C gp140 inmovilizados en la superficie del chip sensor. FabA y FabG 43 y 177 a diversas concentraciones, fueron los analitos. Como resultado (Tabla 1 y Figura S1), cuando el clado B gp41 sirve como objetivo, KD es 3,62 nM para FabA 43 y 21,2 nM para FabA 177 en comparación con 1,12 y 1,22 μM para sus respectivos FabG. Cuando el clado A y C gp140 sirven como objetivo, los KD son 6,41 y 4,79 nM para el FabA 43 en comparación con 500 nM, y no se mide afinidad por el FabG 43 emparejado. KD es igual a 0,29 y 21,5 nM para FabA 177, mientras que el FabG 177 emparejado no tiene una afinidad mensurable por las envolturas virales del clado A o C.

En general, las afinidades por las envolturas del VIH de todos los clados alcanzan el rango nM para los clones FabA 43 y 177, similar al de otros bNAb [22], mientras que permanece en el orden de μM o incluso más bajo para el FabG correspondiente, de acuerdo con experimentos de unión usando ELISA (Fig. 1). Es importante destacar que para todos los Fabs tomados en conjunto, la afinidad se correlaciona con la unión observada por ELISA (r de Spearman = 0,606 p = 0,0375)

Unión de FabA y FabG al péptido P1

El péptido de 35 aminoácidos P1 se caracterizó como la región externa proximal de membrana mínima de la envoltura viral, gp41, que permite la unión del VIH-1 a la galactosilceramida, el receptor de la mucosa del VIH-1 y la entrada del VIH-1 a la mucosa por transcitosis [23 –25]. Esta región altamente conservada se ha utilizado como inmunógeno en una vacuna profiláctica contra el VIH-1 tanto en ensayos de fase I preclínicos como clínicos [20, 26]. La secuencia P1 está bien conservada entre los virus del clado B y A, mientras que una mutación K670S en el virus del clado C evita la unión de la IgG bNAb 2F5 [27]. FabA 43 se obtuvo mediante el cribado de la biblioteca FabA HESN en el clado B P1 y, en consecuencia, FabA 43 se une al clado B P1 [3]. Cuando se estudia por RMN, la estructura tridimensional P1 no es lineal pero contiene 2 hélices separadas por una curva [28]. Por lo tanto, evaluamos mediante ELISA, la capacidad de FabA y G 43 para unirse al clado A, B y C P1, comparativamente como se describe [3]. Ambos isotipos FabA y G 43 se unen a los clados A, B y C P1 de una manera dependiente de la dosis (Fig. 1C). Sorprendentemente como antes, cuando el péptido P1 se expresa en el contexto de una proteína completa (Fig. 1A), FabA 43 reconoce P1 de manera más eficaz que su FabG correspondiente (Fig. 1C). Esta diferencia es mayor cuando el clado B P1 es el objetivo (con un cambio de 60 veces de FabA a G), pero sigue siendo significativa (con un cambio de 20 veces de FabA a G) cuando el clado A y C son objetivos (Fig 1C) . Además, FabA y FabG 43 se unen de manera más eficiente al clado B en comparación con el clado A y C P1 (Fig. 1C). Estas diferencias en la unión del isotipo Fab a P1 de los tres clados también se observan mediante SPR (Fig. S2).

En general, el FabA 43 se une al clado cruzado de la subunidad P1 de gp41 de manera más eficiente que sus contrapartes FabG con una afinidad en el rango nM.

Unión de FabA y FabG a células T CD4 + infectadas por el VIH

A continuación, evaluamos la capacidad de los Fab para unirse a la envoltura viral en su conformación de espiga trimérica en la superficie de las células T CD4 + infectadas con el clado A (aislado primario 92UG031), B (aislado JR-CSF) o virus C (primario aislar 92BR025). Después de la incubación durante la noche a 4 ° C con los diversos Fab, se evaluó la unión mediante citometría de flujo usando un anticuerpo secundario anti-cadena ligera kappa para permitir la comparación directa de isotipos. Todos los Fab se unen específicamente a células infectadas por VIH-1, aunque la unión de FabG a células infectadas por VIH-1 de clado C y A es mucho menor en comparación con FabA. Entre el 20 y el 40% de las células T infectadas por el VIH marcadas para FabA en comparación con el 5 y el 19% para FabG (Student's t–Prueba, p & lt0.05) (Fig. 1D y 1E). FabA 43 reconoce más eficazmente células T CD4 + infectadas con clado A que con clado B y C (figura 1D), mientras que no se observaron diferencias entre los clados para FabA 177 (figura 1E). Es importante destacar que la unión de Fab a células infectadas por VIH-1 se correlaciona con la afinidad de Fab y la unión a la envoltura de VIH-1 medida por ELISA (Fig. 1A-1C) (r de Spearman = 0,777 p = 0,0156) (Fig 2F).

Eficacia antiviral de Fab 43 y 177-A y -G contra los clados A, B y C del VIH-1. (A y B) Inhibición dependiente de la dosis de la infección por VIH-1 mediada por Fab 43 (A) y Fab 177 (B) evaluado en un ensayo de infectividad de ciclo único, usando tinción p24 en células T CD4 +. Para cada clon de Fab, FabA (línea continua) y FabG (línea de puntos), se incubaron durante 1 ha 37 ° C con el clado A del VIH-1 (rojo), el clado B (azul) o con el clado C (verde). antes de la adición de células T CD4 + durante 36 h. Se utilizaron como controles negativos Fab-IgA irrelevantes (línea gris continua) y Fab-IgG (línea gris punteada) a concentraciones similares. El porcentaje de neutralización, analizado por citometría de flujo como se indica en la sección Materiales y métodos, se definió como la reducción de las células infectadas con VIH-1 con Gag-p24 + en comparación con las células infectadas con VIH-1 en ausencia de Fab. Los valores representan la media ± SEM, derivada de al menos 4 experimentos independientes realizados por triplicado. Prueba t de Student, * = p & lt0.01 ** = p & lt0.001 *** = p & lt0.00001. (C y D) Inhibición de la transferencia de VIH-1 de CL a células T CD4 + autólogas evaluadas midiendo la p24 liberada por cocultivos de CL / células T en el día 5. VIH-1 de clado A (rojo), clado B (azul) o El clado C (verde) se preincubó con LC durante 2 h antes de la adición de los Fab (línea continua FabA, línea punteada FabG) y células T CD4 +. Se utilizaron como controles negativos Fab-IgA irrelevantes (línea gris continua) y Fab-IgG (línea gris punteada) a concentraciones similares. Los cocultivos de células LC-T se incubaron a 37 ° C durante 7 días. Los cocultivos LC – T sin Fab se consideraron transferencia del 100% del VIH-1 de LC a células T CD4 + autólogas. La transferencia de virus se evaluó midiendo p24-Ag mediante ELISA como se describe en la sección Material y métodos. Los resultados corresponden al% de inhibición de la transferencia en presencia de Fabs. Los valores representan la media ± SEM de al menos cinco experimentos independientes realizados por triplicado. Prueba t de Student, * = p & lt0.01 ** = p & lt0.01. (E) Correlación entre la actividad neutralizante del VIH-1 y la inhibición de la transferencia. Se correlacionaron la neutralización y la inhibición de la transferencia medidas para el clon 43 y 177 FabA y G a 100 ng / ml. Se indican la correlación de rango de Spearman r y los valores correspondientes. (F) Correlación entre el rendimiento en cada ensayo de cada clon 43 y 177. La proporción de valores obtenidos en cada ensayo indicado para FabA y G emparejados de cada clon, se obtuvo y se trazó como un mapa de calor usando el método de agrupamiento de ligamiento completo y clasificación de acuerdo con las estadísticas de Spearman. La unión representa los valores de DO del ELISA de la envoltura del VIH 1 / La afinidad corresponde a los valores de 1 / log KD.

Propiedades antivirales de FabA y FabG

Neutralización de la infección de células T VIH-1 CD4 + por FabA y FabG.

Como FabA y G solo difieren por el dominio CH1, los resultados presentados anteriormente sugieren que el dominio CH1 afecta el ajuste del paratopo en el antígeno que podría, a su vez, afectar la función antiviral de Ab de una manera dependiente del isotipo.

Therefore, we first investigated the impact of the CH1 isotype in Fab-neutralizing activities. Using a panel of three viruses from clade A, B and C, neutralization of CD4 + T lymphocytes infection by both FabA and G pairs was tested as previously described [3]. Serial dilutions of each FabA and G were assessed comparatively, and IC50 values were determined for each HIV-1 clade. Comparative evaluation of paired Fab 43 isotypes reveals that FaA 43 neutralizes all three A, B and C clades with a respective IC50 of 1ng, 1μg and 100ng/ml, whereas FabG 43 only neutralizes clade A virus with an IC50 of 100ng/ml but not clades B or C virus (Fig 2A). A similar neutralization pattern is observed for the clone 177 with an IC50 of 1ng, 300ng and 30ng/ml for FabA 177 against clade A, B and C virus respectively and an IC50 of 100ng and 1μg for FabG 177 against clade A and C virus, respectively (Fig 2B). In all cases, the paired FabA has significantly-increased neutralization compared to its paired FabG for all concentrations evaluated (Student’s t–test, p values ranging from p<0.01 to p<0.00001). Irrelevant Fab-IgA and Fab-IgG, used as negative controls in parallel experiments lack neutralizing. Of note, cross-neutralization of the Fab we report is based on only one isolate of each clade and should be confirmed on more isolate per clade in future studies.

In summary, for all three HIV-1 clades tested, the CH1α confers to FabA the capacity to neutralize CD4 + T-cell infection whereas the corresponding FabG harboring the same paratope but a different CH1, namely CH1γ, has limited neutralizing activities.

Blockade of cell-to-cell virus transfer by FabA and FabG.

Cell-to-cell transmission of HIV-1 is of major importance en vivo, being much more efficient than infection by cell-free virions [29]. At the mucosal level, HIV-1 entry through multilayer mucosal tissues occurs mainly by targeting Langerhans cells (LCs) that in turn, transfer to CD4 + T-cells [30–33], which constitute the founder-infected cell population. In turn, CD4 + T-cells migrate out of the mucosal tissue, further spreading the virus. Thus, we evaluated the capacity of both pairs of HESN Fabs to block clades A, B and C virus transfer from LCs to CD4 + T-cells. Transfer of clade A and C HIV-1 is inhibited by both FabA 43 and 177 in a concentration-dependent manner, as well as that of clade B by FabA 43, inducing a >40% inhibition at 100ng/ml. Transfer of clade B virus remains much less sensitive to FabA 177 (Fig 2C and 2D). FabG 43 blocks transfer of clade A and C viruses but less efficiently than its FabA counterpart (Fig 2C), and FabG 177 was only able to block clade A HIV-1 transfer (Fig 2D). Irrelevant Fab-IgA and Fab-IgG, used as negative controls, fail to interfere with HIV-1 transfer from LCs to CD4 + T cells.

Of note, taking all the values into consideration (including all viral clades and Fab isotypes) together, at 100ng/ml of Fab, neutralization capacity correlated directly with inhibition of virus transfer (spearman r = 0.6655, p = 0.0219) (Fig 2E).

Taken together, this series of functional analyses demonstrates that switching the CH1α from a mucosal Ab to CH1γ, considerably reduces the Fab antiviral properties, namely both neutralization and HIV-1 transfer from LCs to CD4 + T-cells (Fig 2F).

Identification of FabA- and G-specific mimotopes

The molecular basis by which the CH1 region impacts antibody affinity and functions, could be due to selective molecular stringency/flexibility imposed by the CH1 domain on the paratope conformation. Thus, we aimed to determine the conformational epitopes specific for each Fab isotype, namely clones 43- and 177-specific FabA and FabG.

Consequently, a 12 mer random peptide library was used to characterize a set of the best specific peptides, referred to as mimotopes, of both 43 and 177 clones as FabA and FabG using three rounds of successive screening with increasing stringency, as we have previously described [12]. After sequencing 100 phages specific for each of the Fabs, none of the selected mimotopes correspond to linear sequences of gp41, indicating that Fab epitopes are conformational, as already suggested [3]. Whereas a larger set of mimotopes with high occurrence were retrieved on each of the FabA, a limited number of different phage-expressing peptides bound to FabG, in line with the lower affinity of the FabGs compared with FabAs for gp41 (S1 and S2 Tables).

Conformational FabA and G epitope mapping

The strategy we used to characterize conformational epitopes corresponding to each set of mimotopes, using en silico approaches, is based on mimotope mapping onto trimeric gp41 crystal structures, as described in the Material and Methods section and supplementary data. When experimental techniques such as X-ray crystallography of antibody-antigen interactions turn difficult to use [34], such as in the present case, and when the structure of the target is known, en silico approaches can provide an appropriate means to identify candidate epitopes to be further tested [35], for instance by competition experiments. Only two gp41 crystal structures of a clade B, but not clade A or C gp41, each in a different conformational state, are available. One structure represents gp41 in the pre-fusion state, together with gp120, although this gp41 lacks the MPER region [36]. The other gp41 structure mimics the 6-Helix bundle state and is composed of three N-helices and three C-helices that form a six helix-bundle for completion of HIV-1 fusion with target cells in a “spring-loaded” model of fusion. In this case, the gp41 construct lacks the gp41 Cys-loop bridging the C and N helices [37].

As Fab 43 is primarily specific for the gp41 MPER [3] and the Cys-loop contains important gp41 epitopes [38], we reconstructed en silico the missing parts of clade B gp41 as described in the Material and Methods section using our recently-developed approach [39]. Hence, we first optimized the available crystal structure of gp41 clade B by reconstituting the missing MPER in the pre-fusion structure and the missing loop in the 6-Helix bundle as described in the supplementary data.

Furthermore, as no crystal structures of clade A or C are available in the literature, we constructed clade A and clade C gp41 structures by mapping each of clade A and clade C gp41 sequences onto the clade B gp41 structures, as detailed in the supplementary data. As a result, from these en silico modeling calculations, simulation of clade A, B and C gp41 structures in the pre-fusion and 6-Helix bundle conformations were available for epitope mapping studies.

Selected FabA-specific mimotopes, obtained from FabA 43 and 177, were localized on clade A, B and C gp41 pre-fusion and 6-helix bundle structures, using the PEPsurf method as detailed in supplementary S3 Fig. Two main regions are targeted by FabA 43 mimotopes on gp41 6-helix bundle structure of all three clades, the highest hits being localized on the lower MPER region interface with the N-helix (Fig 3A), in agreement with the screening strategy focusing on P1, used for selecting FabA 43 [3]. In comparison, FabA 43 mimotopes only fit on the clade B pre-fusion structures and with lower scores (Fig 4A). Furthermore, mimotopes fit on each gp41 with slight differences as recapitulated in S3 Table.

Each set of antibody specific mimotopes obtained by biopanning for both isotype FabA clones 43 (A) and 177 (B) were docked on the crystal structure of gp41 under its 6-Helix bundle conformation. Each gp41 monomer in the trimer is highlighted by a different hue of blue. Epitopes are visualized in a color scale according to the scores returned by the PEPsurf algorithm at each position of the sequence (mean of the 3 chains, over 15 conformations extracted each 10 ns from the molecular dynamic simulations) for each set of mimotope. A common color scale varying from never (yellow) to the most frequent on all clades and structures (red) is used, allowing to directly compare epitopes on the three gp41 clades. For each score, a set of random sequences at each position of the sequence had been subtracted to remove background noise.

Each set of antibody specific mimotopes obtained by biopanning for both isotype FabA clones 43 (A) and 177 (B) were docked on the crystal structure of gp41 under its trimeric pre-fusion conformation. Each gp41 monomer in the trimer is highlighted by a different hue of blue. Epitopes are visualized as described in Fig 3 using the same scale to facilitate direct comparison.

The main region targeted by FabA 177 mimotopes on gp41 6-helix bundle structures of all three clades, differs from those targeted by FabA 43 mimotopes, as expected [3]. FabA 177 mimotopes best fit the loop linking the N and C gp41-helices (Fig 3B). These FabA 177-specific mimotopes target an additional domain overlapping the regions mapped by FabA 43 mimotopes, although identified with a much lower score that might not be biologically relevant. Finally, these FabA 177 mimotopes also match gp41 pre-fusion structures as detailed in S2 Table, but with lower scores than the 6-Helix bundle and in a more scattered pattern, irrespective of the clade (Fig 4B) and thus with limited biological relevance.

When FabG sets of specific mimotopes were analyzed similarly, numerous regions were targeted on the various gp41 structures. Corresponding scores might not be relevant biologically, in agreement with the low affinity of FabGs for gp41 and the low number of mimotopes retrieved compared to FabAs. We therefore concentrated our analysis on the FabA 43 and 177 mimotopes.

Design of peptides recapitulating FabA conformational epitopes

To validate experimentally, the FabA conformational epitopes defined en silico as described above, we designed peptides that mimic each conformational FabA epitope and evaluated their capacity to bind their corresponding FabA. To construct these peptides, additional bioinformatic analyses were conducted for each mimotope independently as described in the Material and Methods section.

From these analyses, five peptides specific for FabA 43, namely P7 to P11 could be designed (S4 Table). All of these Fab43 specific peptides appear compatible with the 3-dimensional 6-Helix bundle conformations in all three clades, except P8 which targets only the clade A pre-fusion conformation.

When tested at the biological level for FabA specificity, one out of the five conformational epitopes defined en silico for FabA 43, encompassing regions on both the gp41 N and C-Helixes with LWNWFDISAASI as sequence, and referred to as P7, competes significantly with FabA 43 binding to P1 and gp41/gp140 of the three clades in ELISA when preincubated with the FabA 43 (Figs 5A and S3A) in a concentration-dependent manner (Fig 5B). P7 at 5 μM blocks FabA 43 binding by >50%, reaching >80% at 10μM (Fig 5B). A 9 amino acid peptide derived from the influenza virus hemagglutinin (HA) used as negative control, does not interfere with FabA 43 binding in ELISA (Fig 5A). In contrast, peptide P7 does not interfere with FabG 43 binding to the same antigens (not shown). Taken together, these results indicate that P7 interferes with FabA 43 cross-clade.

(A) Preincubation of FabA 43 with the conformational epitope P7 (5 μM, hatch bars) but not with control HA (5μM, plain bars) interferes significantly with FabA 43 binding to clade A (red), clade B (blue) and clade C (green) P1 of clades A and C gp140 and clade B gp41, as evaluated by competition ELISA as described in Material and Method section. FabA 43 preincubated with P7 or control HA were added to gp41 clade B, gp140 (clades A, C) or P1 (clades A, B, C) coated on the ELISA and their binding was detected by using HRP-coupled anti-human IgA. The percentage of binding was calculated relative to the binding of Fab in the absence of the P7 or control HA. (B) The P7-induced reduction of FabA 43 binding to each antigen is dose dependent. Competition ELISA was done in the same conditions described in A. Binding inhibition to FabA 43 binding to each antigen in the presence of P7 is calculated relative to the binding inhibition in the presence of the irrelevant HA peptide serving as negative control. In A and B, values represent mean ± SEM, derived from 3 independent experiments performed in triplicate. (C) Localization of the amino acid paths corresponding to P7 peptide on the 6-Helix bundle conformation of clades A, B and C gp41 frame15. Each gp41 monomer of the trimer is depicted using a different level of gray. The amino acid paths corresponding to the FaA 43-specific peptide P7 are highlighted in orange. Note residues 532–535 belong to the N-Helix of one monomer while residues 669–672 belong to the C-Helix of another monomer of the trimer. Red: the P7-predicted conformation, superimposed on the structure of gp41. RMSD values over the paired residues of gp41 and P7 are of 2.45, 2.97 and 1.97 Å for clade A, B and C, respectively. Note that in this region of the gp41, only residue 535 differs between clade B in one hand and clade A and C in the other hand. (D) Conformational variability of the predicted conformations of P7 using PEP-FOLD3. Left: conformation best fitting gp41. Right: top 10 predicted conformations superimposed. (MI) Interference of FabA 43 neutralization by a 400-fold molar excess of P7 peptide. FabA 43 preincubated with P7 or control HA were incubated with the HIV-1 of one of each three clades (A, B, C) before adding the activated CD4 + T cells, and cultures were incubated at 37°C for 2 days. Cultures without Fab were served as positive control of infection. The percentage of neutralization, analyzed by flow cytometry as indicated in Materials and Methods section, is shown relative to FabA 43 neutralization using primary CD4 + T cells in the presence of the irrelevant HA peptide, tested in parallel. Values represent mean ± SEM, derived from 3 independent experiments performed in triplicate.

The 12 aminoacid peptide P7 recapitulates a region located at the interface formed by the tips of N- and C-helix of the three clades of gp41 (Fig 5C and 5D). Although P7 has been defined as the best conformational epitope extracted by en silico analyses from FabA 43 mimotope fitting to the 6-Helix bundle clade A gp41 structure, this cross-clade reactivity is expected. Hence, the P7- corresponding region in clade B and C is similar in sequence, although it harbors a I535M substitution in clade B. Our predictions support the hypothesis that P7 mimics a patch on gp41 surface involving two different monomers of the gp41 6-Helix bundle, suggesting that FaA 43 could freeze gp41 in the 6-Helix bundle conformation, thereby preventing further conformational changes of the trimer assembly. The other four conformational peptides defined en silico for FabA 43 that do not interfere with FabA 43 binding to the gp41 antigens are located on different regions of gp41, regardless of the gp41 clade. As two of them are spatially close from the region defined by P7 (S4 Fig), it suggests that the region mapped by P7 on gp41 is highly specific for FabA 43 binding to the HIV-1 envelope. Furthermore, at the functional level, preincubation of FabA 43 with a 400- fold molar excess of P7 blocked the FabA 43 HIV-1 clades A, B and C neutralizing activities with an efficacy of 33±5, 54±8, and 24±11%, respectively (Fig 5E). These results are in good agreement with the antigen-binding blockade observed in ELISA (Fig 5A and 5B).

Finally, six conformational epitopes, referred to as P0 to P6, that best mimic each set of mimotopes specific for FabA 177, were also designed for each gp41 conformation and clade (S2 and S3 Tables). The six peptides extracted from this analysis are compatible with the 3D conformations of at least two clades and interfere all, although to different degrees, with FabA 177 binding to gp41/gp140 of clades A, B and C, with a maximal binding inhibition limited to 23% (S3B Fig). However, no interference was observed with FabA 177 neutralizing activity against HIV-1 of clades A, B and C.


16.3 Sistemas circulatorio y respiratorio

Los animales son organismos multicelulares complejos que requieren un mecanismo para transportar nutrientes por todo el cuerpo y eliminar los desechos. El sistema circulatorio humano tiene una red compleja de vasos sanguíneos que llegan a todas las partes del cuerpo. Esta extensa red suministra oxígeno y nutrientes a las células, los tejidos y los órganos, y elimina el dióxido de carbono y los compuestos de desecho.

El medio de transporte de gases y otras moléculas es la sangre, que circula continuamente por el sistema. Las diferencias de presión dentro del sistema causan el movimiento de la sangre y son creadas por el bombeo del corazón.

El intercambio de gases entre los tejidos y la sangre es una función esencial del sistema circulatorio. En los seres humanos, otros mamíferos y aves, la sangre absorbe oxígeno y libera dióxido de carbono en los pulmones. Así, el sistema circulatorio y respiratorio, cuya función es obtener oxígeno y descargar dióxido de carbono, trabajan en conjunto.

El sistema respiratorio

Inspire y contenga la respiración. Espere varios segundos y luego déjelo salir. Los seres humanos, cuando no se están esforzando, respiran aproximadamente 15 veces por minuto en promedio. Esto equivale a aproximadamente 900 respiraciones por hora o 21,600 respiraciones por día. Con cada inhalación, el aire llena los pulmones y, con cada exhalación, sale rápidamente. Ese aire hace más que inflar y desinflar los pulmones en la cavidad torácica. El aire contiene oxígeno que atraviesa el tejido pulmonar, ingresa al torrente sanguíneo y viaja a los órganos y tejidos. Allí, el oxígeno se intercambia por dióxido de carbono, que es un material de desecho celular. El dióxido de carbono sale de las células, ingresa al torrente sanguíneo, regresa a los pulmones y es expulsado del cuerpo durante la exhalación.

La respiración es un evento voluntario e involuntario. La frecuencia con la que se respira y la cantidad de aire que se inhala o exhala está regulada por el centro respiratorio del cerebro en respuesta a las señales que recibe sobre el contenido de dióxido de carbono de la sangre. Sin embargo, es posible anular esta regulación automática para actividades como hablar, cantar y nadar bajo el agua.

Durante la inhalación, el diafragma desciende creando una presión negativa alrededor de los pulmones y comienzan a inflarse, aspirando aire del exterior del cuerpo. El aire ingresa al cuerpo a través de la cavidad nasal ubicada justo dentro de la nariz (Figura 16.9). A medida que el aire pasa a través de la cavidad nasal, el aire se calienta a la temperatura corporal y se humedece con la humedad de las membranas mucosas. Estos procesos ayudan a equilibrar el aire con las condiciones corporales, reduciendo cualquier daño que pueda causar el aire frío y seco. Las partículas que flotan en el aire se eliminan en los conductos nasales por medio de pelos, moco y cilios. El aire también es muestreado químicamente por el sentido del olfato.

Desde la cavidad nasal, el aire pasa a través de la faringe (garganta) y la laringe (laringe) a medida que avanza hacia la tráquea (Figura 16.9). La función principal de la tráquea es canalizar el aire inhalado hacia los pulmones y el aire exhalado hacia afuera del cuerpo. La tráquea humana es un cilindro, de unos 25 a 30 cm (9,8 a 11,8 pulgadas) de largo, que se encuentra frente al esófago y se extiende desde la faringe hasta la cavidad torácica hasta los pulmones. Está formado por anillos incompletos de cartílago y músculo liso. El cartílago proporciona fuerza y ​​soporte a la tráquea para mantener el pasaje abierto. La tráquea está revestida de células que tienen cilios y secretan moco. El moco atrapa las partículas que se han inhalado y los cilios mueven las partículas hacia la faringe.

El final de la tráquea se divide en dos bronquios que ingresan al pulmón derecho e izquierdo. El aire ingresa a los pulmones a través de los bronquios primarios. El bronquio primario se divide, creando bronquios cada vez más pequeños hasta que los conductos tienen menos de 1 mm (0,03 pulgadas) de diámetro cuando se denominan bronquiolos a medida que se dividen y se extienden a través del pulmón. Al igual que la tráquea, los bronquios y los bronquiolos están formados por cartílago y músculo liso. Los bronquios están inervados por nervios de los sistemas nerviosos parasimpático y simpático que controlan la contracción muscular (parasimpática) o la relajación (simpática) en los bronquios y bronquiolos, según las señales del sistema nervioso. Los bronquiolos finales son los bronquiolos respiratorios. Los conductos alveolares están unidos al final de cada bronquiolo respiratorio. Al final de cada conducto hay sacos alveolares, cada uno de los cuales contiene de 20 a 30 alvéolos. El intercambio de gases ocurre solo en los alvéolos. Los alvéolos tienen paredes delgadas y parecen pequeñas burbujas dentro de los sacos. Los alvéolos están en contacto directo con los capilares del sistema circulatorio. Tal contacto íntimo asegura que el oxígeno se difunda desde los alvéolos hacia la sangre. Además, el dióxido de carbono se difundirá desde la sangre hacia los alvéolos para ser exhalado. La disposición anatómica de los capilares y los alvéolos enfatiza la relación estructural y funcional de los sistemas respiratorio y circulatorio. Las estimaciones de la superficie de los alvéolos en los pulmones varían alrededor de 100 m 2. Esta gran área es aproximadamente el área de media cancha de tenis. Esta gran superficie, combinada con la naturaleza de paredes delgadas de las células alveolares, permite que los gases se difundan fácilmente a través de las células.

Conexión visual

¿Cuál de las siguientes afirmaciones sobre el sistema respiratorio humano es falsa?


Investigations into the Biosynthesis, Regulation, and Self-Resistance of Toxoflavin in Pseudomonas protegens Pf-5

Pseudomonas spp. are prolific producers of natural products from many structural classes. Here we show that the soil bacterium Pseudomonas protegens Pf-5 is capable of producing trace levels of the triazine natural product toxoflavin (1) under microaerobic conditions. We evaluated toxoflavin production by derivatives of Pf-5 with deletions in specific biosynthesis genes, which led us to propose a revised biosynthetic pathway for toxoflavin that shares the first two steps with riboflavin biosynthesis. We also report that toxM, which is not present in the well-characterized cluster of Burkholderia glumae, encodes a monooxygenase that degrades toxoflavin. The toxoflavin degradation product of ToxM is identical to that of TflA, the toxoflavin lyase from Paenibacillus polymyxa. Toxoflavin production by P. protegens causes inhibition of several plant-pathogenic bacteria, and introduction of toxM into the toxoflavin-sensitive strain Pseudomonas syringae DC3000 results in resistance to toxoflavin.

Palabras clave: biocontrol natural products secondary metabolism triazine.


1. INTRODUCCIÓN

Arroz (Oryza sativa L.) is a widely consumed staple food feeding over half of population in the world, especially in Asia (Dong et al., ( 2018 )). During the past decades, China has successfully promoted the cultivation of hybrid rice by developing heterosis, which has greatly increased rice yield (Duan et al., 2013 ). In spite of this, developing high-yield new varieties remains one of the major problems concerning rice breeders due to the growing consumer demand, decreased arable land, and the gradually deteriorating environment. Except for yield, the improvement of grain quality and appearance are also important concerns in rice breeding (Peng et al., 2016 ). However, it is inefficient to select those traits based on direct field observation due to their complexity and vulnerability to environmental influences. For example, the rice yield trait depends on the synergy of various factors, including the spikelet number per panicle and panicles per plant, grain weight, grain filling, plant height, and panicle length (Duan, 2013 Shen et al., 2018 ), while the grain appearance quality is essentially determined by grain length, grain width, and grain density (Bazrkar-Khatibani et al., 2019 Lou et al., 2009 ). In recent years, the development of DNA markers and linkage maps enables the molecular breeding of rice to split complex polygenic traits into single Mendelian QTL (Lou et al., 2009 Zhang, Chen, et al., 2017 ).

The genotyping-by-sequencing (GBS) technology is a rapid, simple, and low-cost genotyping method based on the next-generation sequencing and has the capacity of identifying a number of DNA sequences near enzyme cleavage sites and single nucleotide polymorphism (SNP) information for a plant species (Elshire et al., 2012 ). It has been wildly used in the construction of the genetic map, the studies of animal/plant population evolution, and the auxiliary genome assembly (Poland & Rife, 2012 Pootakham et al., 2015 ). The high-throughput SNP genotyping method has also been wildly used in the QTL mapping marker-assisted breeding in rice (Angaji, 2009 Zhang et al., 2017 ). Tang and colleagues characterized the genome-wide SNPs of the parental varieties of recombinant inbred line (RIL) populations using the high-throughput GBS and identified a QTL containing the locus Os4g48460 (a putative cytochrome P450) related to rice seed size (Tang et al., 2016 ). Zhu performed QTL mapping in a restorer line of hybrid rice based on ultra-high-density SNP mapping and found 26 QTLs for six yield traits, in which nine QTL alleles presented a significant effect (Zhu et al., 2017 ). Jiang performed the high-density genetic map in the QTL mapping of 124 rice backcrossed recombinant inbred lines and showed six QTLs related to seed germination in response to the cold stress (Jiang et al., 2017 ).

In this study, the F8 recombinant inbred lines (RILs), developed from the cross Dexiang074B and Pujiang6, were used. Dexiang074B, as a high-combining ability hybrid rice maintainer line, is currently one of the rice backbone parents in Sichuan province and combines high grain quality and yield. Its hybrid progeny, Deyou 4727, passed the national examination and approval in 2014 and was named "green super rice" in 2019. As an indica three-line hybrid rice, this variety is widely planted in the upper and middle reaches of the Yangtze River. It has characteristics of large grains, high seed setting rate, high yield (rice yield is up to 15.0 t/ha), excellent rice quality, and moderate resistance to rice blast. Pujiang6, a farm variety with rounded grain appearance, displays great differences with the economic traits of Dexiang074B. To further understand the genetic basis of agricultural traits in the RILs of rice, including heading data, grain length, grain width, thousand kernel weight, grain density, panicle length, the panicle number, and plant height, we performed genome-wide SNP discovery and QTL mapping for the RIL (F8) population using high-density GBS-based SNP linkage mapping. A total of 426 additive QTLs were identified for the eight agricultural traits with different environments or methods. Importantly, 98 highly reliable QTLs can be detected repeatedly by multiple methods or multiple environments. This study provides a genetic basis for developing cultivated rice with economic characteristics based on the molecular breeding technology.


Contenido

JAK2 gene fusions with the TEL(ETV6) (TEL-JAK2) and PCM1 genes have been found in patients suffering leukemia, particularly clonal eosinophilia forms of the disease. [11] [12] [13]

Mutations in JAK2 have been implicated in polycythemia vera, essential thrombocythemia, and myelofibrosis as well as other myeloproliferative disorders. [14] This mutation (V617F), a change of valine to phenylalanine at the 617 position, appears to render hematopoietic cells more sensitive to growth factors such as erythropoietin and thrombopoietin, because the receptors for these growth factors require JAK2 for signal transduction. An inhibitor of JAK2-STAT5, AZD1480, was pointed as having activity in primary and CRPC. [15] Jak2 mutation, when demonstrable, is one of the methods of diagnosing polycythemia vera. [dieciséis]

Janus kinase 2 has been shown to interact with:

Prolactin signals through JAK2 are dependent on STAT5, and on the RUSH transcription factors. [60]


Contenido

Khorana was born to Krishna Devi Khorana and Ganpat Rai Khorana, in Raipur, a village in Multan, Punjab, British India in a Punjabi Hindu family. [9] The exact date of his birth is not certain but he believed that it might have been 9 January 1922 [10] this date was later shown in some documents, and has been widely accepted. [11] He was the youngest of five children. His father was a patwari, a village agricultural taxation clerk in the British Indian government. In his autobiography, Khorana wrote this summary: "Although poor, my father was dedicated to educating his children and we were practically the only literate family in the village inhabited by about 100 people." [12] The first four years of his education were provided under a tree, a spot that was, in effect, the only school in the village. [9]

He attended D.A.V. (Dayanand Anglo-Vedic) High School in Multan, in West Punjab. [9] Later, he studied at the Punjab University in Lahore, with the assistance of scholarships, where he obtained a bachelor's degree in 1943 [12] and a Master of Science degree in 1945. [4] [13]

Khorana lived in British India until 1945, when he moved to England to study organic chemistry at the University of Liverpool on a Government of India Fellowship. He received his PhD in 1948 advised by Roger J. S. Beer. [14] [15] [16] [12] The following year, he pursued postdoctoral studies with Professor Vladimir Prelog at ETH Zurich in Switzerland. [12] He worked for nearly a year on alkaloid chemistry in an unpaid position. [9] [16]

During a brief period in 1949, he was unable to find a job in his original home area in the Punjab. [9] He returned to England on a fellowship to work with George Wallace Kenner and Alexander R. Todd on peptides and nucleotides. [16] He stayed in Cambridge from 1950 until 1952.

He moved to Vancouver, British Columbia, with his family in 1952 after accepting a position with the British Columbia Research Council at University of British Columbia. [12] [17] Khorana was excited by the prospect of starting his own lab, a colleague later recalled. [9] His mentor later said that the Council had few facilities at the time but gave the researcher "all the freedom in the world". [18] His work in British Columbia was on "nucleic acids and synthesis of many important biomolecules" according to the American Chemical Society. [14]

In 1960 Khorana accepted a position as co-director of the Institute for Enzyme research at the Institute for Enzyme Research at the University of Wisconsin at Madison. [14] [19] He became a professor of biochemistry in 1962 and was named Conrad A. Elvehjem Professor of Life Sciences at Wisconsin–Madison. [20] While at Wisconsin, "he helped decipher the mechanisms by which RNA codes for the synthesis of proteins" and "began to work on synthesizing functional genes" according to the American Chemical Society. [14] During his tenure at this University, he completed the work that led to sharing the Nobel prize. The Nobel web site states that it was "for their interpretation of the genetic code and its function in protein synthesis". Har Gobind Khorana's role is stated as follows: he "made important contributions to this field by building different RNA chains with the help of enzymes. Using these enzymes, he was able to produce proteins. The amino acid sequences of these proteins then solved the rest of the puzzle." [21]

He became a US citizen in 1966. [22] Beginning in 1970, Khorana was the Alfred P. Sloan Professor of Biology and Chemistry at the Massachusetts Institute of Technology [23] [12] [24] and later, a member of the Board of Scientific Governors at The Scripps Research Institute. He retired from MIT in 2007. [22]

Har Gobind Khorana married Esther Elizabeth Sibler in 1952. They had met in Switzerland and had three children, Julia Elizabeth, Emily Anne, and Dave Roy.

Ribonucleic acid (RNA) with two repeating units (UCUCUCU → UCU CUC UCU) produced two alternating amino acids. This, combined with the Nirenberg and Leder experiment, showed that UCU genetically codes for serine and CUC codes for leucine. RNAs with three repeating units (UACUACUA → UAC UAC UAC, or ACU ACU ACU, or CUA CUA CUA) produced three different strings of amino acids. RNAs with four repeating units including UAG, UAA, or UGA, produced only dipeptides and tripeptides thus revealing that UAG, UAA, and UGA are stop codons. [25]

Their Nobel lecture was delivered on 12 December 1968. [25] Khorana was the first scientist to chemically synthesize oligonucleotides. [26] This achievement, in the 1970s, was also the world's first synthetic gene in later years, the process has become widespread. [23] Subsequent scientists referred to his research while advancing genome editing with the CRISPR/Cas9 system. [22]

Subsequent research

He extended the above to long DNA polymers using non-aqueous chemistry and assembled these into the first synthetic gene, using polymerase and ligase enzymes that link pieces of DNA together, [26] as well as methods that anticipated the invention of polymerase chain reaction (PCR). [27] These custom-designed pieces of artificial genes are widely used in biology labs for sequencing, cloning and engineering new plants and animals, and are integral to the expanding use of DNA analysis to understand gene-based human disease as well as human evolution. Khorana's invention(s) have become automated and commercialized so that anyone now can order a synthetic oligonucleotide or a gene from any of a number of companies. One merely needs to send the genetic sequence to one of the companies to receive an oligonucleotide with the desired sequence.

After the middle of the 1970s, his lab studied the biochemistry of bacteriorhodopsin, a membrane protein that converts light energy into chemical energy by creating a proton gradient. [28] Later, his lab went on to study the structurally related visual pigment known as rhodopsin. [29]

A summary of his work was provided by a former colleague at the University of Wisconsin: "Khorana was an early practitioner, and perhaps a founding father, of the field of chemical biology. He brought the power of chemical synthesis to bear on deciphering the genetic code, relying on different combinations of trinucleotides." [14] [4]

In addition to sharing the Nobel prize (while he was working at the University of Wisconsin–Madison in the U.S.), [13] Khorana was elected as Foreign Member of the Royal Society (ForMemRS) in 1978. [30] In 2007, the University of Wisconsin–Madison, the Government of India (DBT Department of Biotechnology), and the Indo-US Science and Technology Forum jointly created the Khorana Program. The mission of the Khorana Program is to build a seamless community of scientists, industrialists, and social entrepreneurs in the United States and India.

The program is focused on three objectives: [31] Providing graduate and undergraduate students with a transformative research experience, engaging partners in rural development and food security, and facilitating public-private partnerships between the U.S. and India. The Wisconsin–India Science and Technology Exchange Program (WINStep Forward, WSF) adopted administration responsibilities for the Khorana program in 2007. [32] WINStep Forward was jointly created by Drs. Aseem Ansari and Ken Shapiro at the University of Wisconsin–Madison. WINStep Forward also administers the nationally competitive S.N. Bose Programs for Indian and American students, respectively, to promote both fundamental and applied research not only in biotechnology but broadly across all STEM (science, technology, engineering, and mathematics) fields, including medicine, pharmacy, agriculture, wildlife and climate change.

In 2009, Khorana was hosted by the Khorana Program and honored at the 33rd Steenbock Symposium in Madison, Wisconsin. [19]

Other honors included the Louisa Gross Horwitz Prize from Columbia University and the Lasker Foundation Award for Basic Medical Research, both in 1969, the Golden Plate Award of the American Academy of Achievement in 1971, [33] the Willard Gibbs Medal of the Chicago section of the American Chemical Society, in 1974, the Gairdner Foundation Annual Award, in 1980 and the Paul Kayser International Award of Merit in Retina Research, in 1987. [12]

On 9 January 2018, a Google Doodle celebrated the achievements [34] of Har Gobind Khorana on what would have been his 96th birthday. [35] [36]

Khorana died on 9 November 2011, in Concord, Massachusetts, at the age of 89. His wife, Esther, and daughter, Emily Anne, had died earlier, [14] but Khorana was survived by his other two children. [10] Julia Elizabeth later wrote about her father's work as a professor: "Even while doing all this research, he was always really interested in education, in students and young people." [12]


Ver el vídeo: Clonación de ADN y ADN recombinante. Biología. Khan Academy en Español (Junio 2022).


Comentarios:

  1. Maceo

    Creo que estas equivocado. Envíame un correo electrónico a PM.

  2. Yozshulkis

    el punto de vista autoritario, seductoramente

  3. Aleeyah

    Te pido disculpas, pero, en mi opinión, no tienes razón. estoy seguro Puedo probarlo. Escríbeme por PM, hablamos.



Escribe un mensaje