Información

¿Por qué obtengo una baja eficiencia de transformación con las células DB3.1 de E. coli?

¿Por qué obtengo una baja eficiencia de transformación con las células DB3.1 de E. coli?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Estoy haciendo células competentes usando DB3.1 E. coli células. Incluso después de seguir el protocolo exacto (método Inoue para células ultracompetentes) dado en 'Sambrook y Russel', no obtengo una eficiencia de transformación de más de 104. Estoy usando un plásmido de 5.1 kb para verificar la eficiencia de transformación.

Estaré agradecido si alguno de ustedes puede compartir su experiencia en este experimento.


¿Cómo almacena las células? Las células competentes pueden ser muy delicadas. En mi laboratorio, generalmente los congelamos instantáneamente con etanol / hielo seco y los almacenamos a -81 grados (uso a largo plazo) o los almacenamos rodeados de hielo a 4 grados (uso a corto plazo).


Clonación fallida con un extremo pegajoso y n. ° 38 con un extremo romo - Baja eficiencia de transformación y las colonias n. ° 38 no contienen inserto (25 / Nov / 2010)

Estoy tratando de ligar un inserto de 1,5 kb en el MCS de un vector de 5,3 kb y hasta ahora no he logrado aislar un plásmido con la construcción de interés. Dije el vector con BamHI-HF (extremo adhesivo) y EcoRV-HF (extremo romo), y el inserto con BamHI-HF (extremo adhesivo) y SmaI (extremo romo). Después de la digestión, purificaba en gel y extraía tanto el vector como el inserto, y usaba el kit de ligadura rápida de NEB para ligar los dos fragmentos. Después de la ligadura, usaría aproximadamente la mitad de la reacción de ligadura para transformar la bacteria DB3.1 de Invitrogen (me he transformado varias veces con esta cepa sin ningún problema) y el resto (

10 ul) Analizaría en un gel y digerir con las enzimas apropiadas para cortar el inserto si la ligadura fue exitosa. He probado varios vectores diferentes: proporciones de inserción y cada vez que ejecuto el producto de ligadura obtengo bandas

11-12 kb, que no es representativo del ADN circular, que se ejecutaría más rápido, o incluso del ADN lineal (5,3 kb + 1,5 kb = 6,8 kb). Las bandas de la digestión del producto de ligadura tampoco están en los rangos de tamaño correctos. Finalmente, después de la transformación, obtengo eficiencias de transformación MUY bajas (1-2 colonias por placa de agar) y el plásmido aislado no contiene el inserto (lo que tampoco tiene sentido ya que los extremos no son compatibles).

Llamé a NEB y su soporte técnico sugirió usar una fosfatasa en el vector para prevenir la autoligación en el corte del extremo romo con EcoRV, sin embargo, obtuve los mismos resultados extravagantes en el gel y bajas eficiencias de transformación después de usar la fosfatasa antártica. Mi siguiente paso es renunciar a esto y simplemente sacar el inserto por PCR de su plásmido e introducir sitios de restricción que produzcan extremos pegajosos para hacer mi vida más fácil. ¿Alguien tiene alguna sugerencia sobre por qué estoy viendo los resultados que estoy observando del procedimiento que he descrito? ¿Hay algo que pueda probar antes de comprar cebadores y una nueva enzima para la clonación por PCR? Gracias y avísame si necesito aclarar alguno de mis pasos.

Adjunto una foto del gel para ayudar a aclarar.
G.E. = gel extraído
A.P. = Fosfatasa antártica

¿Cómo preparaste el inserto? Digerido del vector pGEMT ?. Si la digestión en ambos extremos es correcta y también en el vector, obtendrás el clon. hicimos un poco de clonación, obtuvimos el clon.

UCI_StemCell el jueves 25 de noviembre 23:39:01 2010 dijo:

10 ul) Analizaría en un gel y digerir con las enzimas apropiadas para cortar el inserto si la ligadura fue exitosa. He probado varios vectores diferentes: proporciones de inserción y cada vez que ejecuto el producto de ligadura obtengo bandas

11-12 kb, que no es representativo del ADN circular, que se ejecutaría más rápido, o incluso del ADN lineal (5,3 kb + 1,5 kb = 6,8 kb). Las bandas de la digestión del producto de ligadura tampoco están en los rangos de tamaño correctos. Finalmente, después de la transformación, obtengo eficiencias de transformación MUY bajas (1-2 colonias por placa de agar) y el plásmido aislado no contiene el inserto (lo que tampoco tiene sentido ya que los extremos no son compatibles).

Llamé a NEB y su soporte técnico sugirió usar una fosfatasa en el vector para prevenir la autoligación en el corte del extremo romo con EcoRV, sin embargo, obtuve los mismos resultados extravagantes en el gel y bajas eficiencias de transformación después de usar la fosfatasa antártica. Mi siguiente paso es renunciar a esto y simplemente sacar el inserto por PCR de su plásmido e introducir sitios de restricción que produzcan extremos pegajosos para hacer mi vida más fácil. ¿Alguien tiene alguna sugerencia sobre por qué estoy viendo los resultados que estoy observando del procedimiento que he descrito? ¿Hay algo que pueda probar antes de comprar cebadores y una nueva enzima para la clonación por PCR? Gracias y avísame si necesito aclarar alguno de mis pasos.

Adjunto una foto del gel para ayudar a aclarar.
G.E. = gel extraído
A.P. = Fosfatasa antártica

Bueno, es un plásmido de Origene que contiene un gen NGF-GFP que estoy digiriendo y tratando de ligar en el MCS de un vector diferente. La digestión debe haberse llevado a cabo hasta su finalización, de lo contrario no habría podido separar el inserto del "plásmido madre" en un gel y extraerlo en gel. Simplemente no puedo explicar la BAJA eficiencia de transformación y los extraños resultados del gel cuando ejecuto los productos de ligadura.

Circular abierta El ADN no corre más rápido que su equivalente lineal, corre más lento. Es la forma circular superenrollada de la molécula de plásmido de ADN la que corre más rápido. La reacción de ligación solo produce ADN circular abierto, con poco o ningún superenrollamiento.

Dado que puede ver bandas de alto peso molecular, al menos sabemos que la ligasa está funcionando. Supongo que la mezcla de ligación se probó justo antes de la transformación (no se realizaron más manipulaciones en la mezcla de ligación) y, por lo tanto, no es un caso de pérdida de ADN después de la desalación (asumiendo que la electroporación fue el método de transformación utilizado)

Esto deja dos lugares para buscar problemas. La restricción digerir y la transformación.

Primero, puede decirnos las condiciones que utilizó para digerir el vector e insertar. En particular, el resumen de SmaI. ¿Podría decirnos cómo se hizo el inserto? ¿Fue por PCR? ¿Se purificó el gel de inserción? ¿A qué distancia están los sitios de restricción BamHI y EcoRV en el vector?

¿Puede contarnos cómo se realizó la transformación? ¿Es esto electroporación, transformación química? ¿Desalaste el ADN de antemano? ¿Hay algún problema con las células?

perneseblue el viernes 26 de noviembre 03:52:38 2010 dijo:

Circular abierta El ADN no corre más rápido que su equivalente lineal, corre más lento. Es la forma circular superenrollada de la molécula de plásmido de ADN la que corre más rápido. La reacción de ligación solo produce ADN circular abierto, con poco o ningún superenrollamiento.

Dado que puede ver bandas de alto peso molecular, al menos sabemos que la ligasa está funcionando. Supongo que la mezcla de ligación se probó justo antes de la transformación (no se realizaron más manipulaciones en la mezcla de ligación) y, por lo tanto, no es un caso de pérdida de ADN después de la desalación (asumiendo que la electroporación fue el método de transformación utilizado)

Esto deja dos lugares para buscar problemas. La restricción digerir y la transformación.

Primero, puede decirnos las condiciones que utilizó para digerir el vector e insertar. En particular, el resumen de SmaI. ¿Podría decirnos cómo se hizo el inserto? ¿Fue por PCR? ¿Se purificó el gel de inserción? ¿A qué distancia están los sitios de restricción BamHI y EcoRV en el vector?

¿Puede contarnos cómo se realizó la transformación? ¿Es esto electroporación, transformación química? ¿Desalaste el ADN de antemano? ¿Hay algún problema con las células?

Tiene razón en su suposición, la imagen que adjunto presenta el producto de ligadura digerido y no digerido antes de la transformación.

Ambas digestiones del vector y del plásmido que contiene el inserto se realizaron en un volumen de reacción de 40 ul. Para la digestión de vectores, agregué

11 ul) de ADN a 4 ul de NEBuffer4 y 20-25U de EcoRV-HF y se llenó el resto del volumen con dH2O. Digerí durante 30 minutos a 37 ° C, momento en el que agregué 25U de BamHI-HF a la reacción para digerir a 37 ° C durante otros 30 minutos. Después del corte romo de EcoRV, solo hay 3 pares de bases entre el extremo del fragmento de ADN y el sitio de reconocimiento de BamHI, sin embargo, esto no debería ser un problema ya que BamHI tiene una eficiencia de escisión del 97% con solo 1 pb desde el final. Cuando realicé el paso de la fosfatasa, agregué 10 ul de tampón de fosfatasa y 1 ul de fosfatasa antártica directamente a la mezcla de digestión y lo incubé a 37 ° C durante 15 minutos durante 5 & # 39 extremos pegajosos y extremos romos como indica el protocolo.

La digestión del plásmido Origene se realizó de manera similar, comenzando con la digestión con SmaI a 25ºC durante 30 minutos y luego añadiendo BamHI durante otros 30 minutos de digestión a 37ºC.

Después de los tiempos de digestión, dividí los volúmenes de reacción en 4 pocillos por reacción en un gel de agarosa al 0,9% y el gel se extrajo después de una cantidad de tiempo suficiente para hacer correr el gel.

Después de la extracción del gel, probé una relación de inserción: vector de 8: 2 y 8: 1 (en términos de volumen, en cuanto al peso molecular, debería ser 50 ng de vector +

43 ng de inserto) en 10 ul de tampón de ligación y 1 ul de ligasa del kit de ligadura rápida de NEB. El ADN no fue desalado porque no estoy usando electroporación. He usado células DB3.1 no competentes de Invitrogen para transformaciones antes y no he tenido ningún problema. Hago que las células sean competentes con CaCl2 y llevo a cabo un protocolo de transformación normal antes de colocarlas en placas de agar LB / Amp. Después de la incubación durante la noche a 37 ° C, veo entre 0 y 2 colonias por placa.

Una cosa que no mencioné es que hice esta ligadura exacta en el pasado con resultados similares (baja eficiencia de transformación de solo dos colonias en la placa de agar LB / Amp) y AFORTUNADA, ambas colonias contenían el inserto ligado exitosamente en el vector columna vertebral. No sé por qué la eficiencia es tan baja y por qué no tengo la suerte esta vez de obtener la construcción correcta.

Gracias por cualquier sugerencia que pueda ofrecer.

lo primero que noté es el tiempo de digestión bastante corto. Es mucho más corto de lo que haría yo. El ADN aún sin cortar debería conducir a más células y no explicaría por qué se recuperaron tan pocas colonias. 100 - 300 por plato sería el número que esperaba.

Mi sugerencia sería mirar la eficiencia de la transformación. Me pregunto si hay algún problema con las células.

Personalmente, también cortaría más ADN durante un período más largo. Ejecutar en cantidades tan pequeñas de ADN me da nerviosismo.

Las células competentes preparadas con CaCl2 tienen baja eficiencia. Además, ¿por qué está utilizando celdas DB3.1? ¿Hay un inserto de ccdB en su ensamblaje? De lo contrario, no estaría usando DB3.1, sino Top10 o equivalente. Y los compraría si tuviera problemas. Si necesita preparar celdas DB3.1, he hecho algunas buenas con el protocolo en Openwetware aquí:
http://openwetware.org/wiki/TOP10_chemically_competent_cells

phage434 el viernes 26 de noviembre 06:25:39 2010 dijo:

No hay ninguna razón en particular por la que esté usando células DB3.1, simplemente estaban disponibles en mi laboratorio. Creo que también hay celdas XL1. Realmente no he tenido ningún problema con las celdas DB3.1 hasta ahora. ¿Sugerirían probar la XL1 o incluso otra cepa de células bacterianas? Creo que tengo otras dos cepas competentes de Strategene, pero cada vez que intento transformarme con las células competentes de Stratagene (XL1-Blue y amp SCS110), no obtengo colonias, y sigo su protocolo al pie de la letra. # 39t ha tenido éxito con sus bacterias todavía ...

Como ya le dije, sugeriría cortar más ADN, especialmente su futuro inserto, y maximizar la cantidad de inserto en la ligadura. También pruebe la ligadura durante la noche.


¿Seguiste correctamente el protocolo de transformación?

Si eres un principiante (como yo), el protocolo es lo primero que debes verificar. Por lo general, los laboratorios tienen sus propios protocolos que se le pasan una vez que comienza a trabajar allí. Pero, ¿son precisos y están actualizados? Lo sé, tienes demasiado miedo para preguntarle a tu P.I. o incluso la persona que te pasó los protocolos. Sin embargo, por el bien de su experimento, siempre haga una revisión rápida de la literatura / protocolo para ver si el protocolo que tiene es consistente y correcto.


Soporte de expresión de levadura: solución de problemas

Estamos dedicados a su éxito. Volver a la pista. Vea nuestras recomendaciones de expertos para escenarios de problemas que se encuentran comúnmente.

Vea las preguntas relevantes a continuación:

¿Comenzando tu experimento?
Visita nuestro

A continuación, se incluyen algunas cosas a considerar:

  1. Si la DO de las células que se utilizan es demasiado alta, no producirán esferoplasto. No crezca demasiado las células.
  2. No utilice células viejas y asegúrese de que estén en fase logarítmica de crecimiento.
  3. Asegúrese de mezclar bien la zymolyase antes de usar. Zymolyase es más una suspensión que una solución.
  4. Haga que la solución de PEG sea fresca cada vez y verifique el pH.
  • Asegúrese de haber recolectado células durante el crecimiento en fase logarítmica (OD & lt1.0 generalmente).
  • Si se utiliza electroporación, consulte el manual del electroporador para conocer las condiciones sugeridas. Varíe los parámetros de electroporación si es necesario.
  • Usa más ADN.
  • Utilice células competentes recién hechas.
  • Si se está utilizando el método de transformación de LiCl, intente hervir el ADN portador.

A continuación, se muestran las posibles causas y soluciones:

Es posible que el pH de la Solución I o la Solución III se haya desviado. El pH de ambos
las soluciones deben ser 8.0

Verifique el pH de las Soluciones I y III. Si el pH es bajo, auméntelo agregando NaOH. Si el pH es alto, redúzcalo agregando HCl. Almacene las soluciones a 4 ° C para minimizar la deriva en el pH.

Reacción de transformación no mixta
durante la incubación

Asegúrese de mezclar la reacción de transformación cada 15 minutos durante la incubación de 1 hora a 30 ° C. El vórtex funciona mejor.

El tiempo de incubación es demasiado corto o la temperatura es demasiado baja

Pichia pastoris las transformaciones se pueden incubar durante períodos de tiempo más prolongados (hasta 3 horas) y a una temperatura más alta (35–37 ° C). En algunos casos, esto puede resultar en una mayor eficiencia de transformación.

La densidad celular es demasiado baja (OD600 y lt0.6)

Resuspender las células de Preparación de células competentes, Paso 6, página 1 del manual, en un volumen más pequeño (es decir, 500 μL).

Generalmente, las colonias grandes representan transformantes que contienen integrantes de pPIC6 / pPIC6α, mientras que las colonias pequeñas representan transformantes que contienen no integrantes de pPIC6 / pPIC6α. Estos no integrantes han transducido el plásmido pPIC6 / pPIC6α y, por lo tanto, exhiben un bajo nivel de resistencia a blasticidina en el proceso de selección inicial. Tras el escrutinio posterior, estos transformantes no integrantes no retienen la resistencia a blasticidina.

Al elegir un transformante resistente a blasticidina para sus estudios de expresión, le recomendamos que elija colonias resistentes a blasticidina de la placa de transformación inicial y las extienda en una segunda placa YPD que contenga la concentración adecuada de blasticidina. Seleccione transformantes que permanezcan resistentes a blasticidina para estudios adicionales.

Cuando se usa el vector pPink-HC, la eficiencia de transformación de la cepa huésped puede parecer baja porque las colonias con solo unas pocas copias del marcador no producirán suficiente ADE2 producto génico para crecer y se seleccionará contra un medio que carece de adenina (es decir, medio de eliminación de adenina o medio mínimo). Solo las colonias que han integrado múltiples copias del ADE2 El marcador podrá crecer sin adenina. Dado que el gen de interés está vinculado al marcador de selección, las colonias blancas también podrían resultar en una mayor expresión del gen de interés.

Es probable que esto se deba al bajo nivel de inóculo. Recomendamos tener un cultivo iniciador para usar, ya que es más preciso que usar una colonia. Puede utilizar el tiempo de duplicación para calcular la DO inicial. En YPD, el tiempo de duplicación es de aproximadamente 1,5 horas. En MGY, el tiempo de duplicación será de aproximadamente 3 horas.


MATERIALES Y MÉTODOS

Condiciones de cultivo:

Thermoanaerobacterium cepa JW / SL-YS485 (DSM 8691), ahora identificada como T. saccharolyticum JW / SL-YS485 (Rainey y Wiegel, inédito), aislado en nuestro laboratorio, se cultivó en medio mineral prerreducido (24) o en el mismo medio suplementado con 50 a 800 & # x003bcg de kanamicina / ml (medio selectivo). JW / SL-YS485 de tipo salvaje es sensible a 50 & # x003bcg de kanamicina / ml pero resistente a 100 & # x003bcg de ampicilina / ml. E. coli TG1 (supE hsd & # x003945 thi & # x00394 & # x0005blac-proAB& # x0005d & # x0005bF & # x02032 traD36 proAB lacI q Z & # x00394M15& # x0005d) en medio Luria-Bertani, el medio selectivo se suplementó con ampicilina (100 & # x003bcg ml & # x022121) o kanamicina (50 & # x003bcg ml & # x022121).

Construcción de plásmido.

El plásmido pIKM3 (9 kb & # x0005bFig. 1 & # x0005d) se construyó como sigue. Usando procedimientos de subclonación estándar (2), el plásmido pLAL602 se digirió con EcoRHODE ISLAND/BamHI, y la banda de 2,7 kb que contiene el manA gen de Caldicelululosiruptor la cepa Rt8B4 (4) se aisló de un gel de agarosa 1 & # x00025 después de la electroforesis. Posteriormente, el ADN se ligó en EcoRHODE ISLAND/BamPIKM1 digerido con HI (6,3 kb). Los plásmidos pIKM5 (11 kb) y pIKM6 (8,3 kb) se construyeron correspondientemente ligando el clonado celD / celS de Clostridium thermocellum (7, 23) en EcoRHODE ISLAND/KpnYo y XbaI/KpnCorte en I pIKM1, respectivamente (Fig. & # X200B (Fig.1). 1). Los plásmidos pIKM4 (8,4 kb) y pIKM7 (8,8 kb) se construyeron ligando la secuencia señal, amplificada por PCR desde el extremo 5 & # x02032 de T. saccharolyticum JW / SL-YS485 xynA, en el marco de manA y celS, respectivamente. El plásmido pIKM8 (10,1 kb) se construyó insertando el amplificado por PCR cbhA de C. thermocellum dentro XbaI/SmaCorte pIKM1.

Construcción de los plásmidos pIKM3, pIKM4, pIKM5, pIKM6, pIKM7 y pIKM8 a partir de E. coli-Thermoanaerobacterium vector lanzadera pIKM1. MCS, sitio de clonación múltiple MLS, macrólido lincosamida estreptogramicidina.

El plásmido pRKM1 se construyó como sigue (Fig. & # X200B (Fig. 2). 2). Usando procedimientos de subclonación estándar (2), el plásmido pKD102 (21) se digirió con EcoRHODE ISLAND/PstI, y la banda de 1,6 kb que contiene el casete de resistencia a kanamicina se aisló de un gel de agarosa 1 & # x00025 después de la electroforesis. Posteriormente, el ADN se ligó en EcoRHODE ISLAND/PstPRP9 digerido con I (2,9 kb), produciendo el plásmido pRKM1 (4,5 kb). El plásmido pRUKM1 se construyó ligando pUC18 en pRKM1, ambos digeridos con EcoRHODE ISLAND/BamHOLA.

Construcción de vectores lanzadera pRKM1 y pRUKM1 y vectores suicidas pUXK y pUXKC. MCS, sitio de clonación múltiple.

El vector suicida pUXK se construyó ligando el casete de resistencia a la kanamicina del vector lanzadera pIKM1 digerido con SmaI /PstYo en EcoRV /NsiPUC19 digerido con IxynA, que lleva el clonado T. saccharolyticum xynA gene. De manera similar, el vector suicida pUXKC se construyó fusionando amplificado por PCR cbhA de C. thermocellum al casete de resistencia a kanamicina en pUXK (Fig. & # x200B (Fig.2 2).

Transformación de T. saccharolyticum JW / SL-YS485.

Las transformaciones se realizaron como se describió anteriormente (16). Brevemente, las células se cultivaron en tubos Hungate con 10 ml de medio mineral prerreducido a 60ºC. Se añadió hidrazida de ácido isonicotínico (isoniacina) a los cultivos en la fase exponencial temprana a una concentración final de 4 & # x003bcg ml & # x022121 para debilitar la pared celular (5). Las células se recolectaron y lavaron en agua estéril prerreducida o sacarosa 270 mM (N2 enjuagado 1 & # x003bcmol de Na2S / ml añadidos). La transformación se realizó mediante un único pulso de electroporación (1,25 kV, 400 & # x003a9, 25 mF) usando un generador de pulsos de genes Bio-Rad.

Aislamiento de plásmidos.

ADN plasmídico de transformado E. coli Se aisló TG1 usando kits comerciales de minipreparación (Qiagen y Promega). ADN plasmídico de transformado T. saccharolyticum JW / SL-YS485 se extrajo inicialmente mediante el procedimiento de aislamiento modificado de O'Sullivan y Klaenhammer (17) como se describió anteriormente (16). Además, después de la lisis celular mediada por lisozima, se utilizó con éxito un kit comercial de minipreparación (Qiagen).

Amplificación por PCR.

La amplificación por PCR se realizó mediante el uso de un termociclador Perkin-Elmer de acuerdo con las instrucciones del fabricante. Taq polimerasa y Tfl Se utilizó polimerasa (Promega) en las reacciones con los tampones suministrados. Los cebadores para la amplificación por PCR se diseñaron utilizando el software OLIGO y contenían sitios de reconocimiento de enzimas de restricción en sus extremos 5 & # x02032 para la subclonación posterior. Los productos de PCR se clonaron primero en pGM-T (Promega) antes de que se realizara la subclonación. Los cebadores utilizados fueron los siguientes: cebador 1 (secuencia señal xynA amplificación para ligadura a manA y celS), 5 & # x02032 ATCGTCTAGATAGTGTCAGTGGTT 3 & # x02032 cebador 2 (secuencia de señal xynA amplificación para ligadura a manA), 5 & # x02032 TCATCCATGGTGCTTGTTCAGTAG 3 & # x02032 cebador 3 (secuencia de señal xynA amplificación para ligadura a celS), 5 & # x02032 TCATCTGCAGTTGCTGCTTGTTCAGTA 3 & # x02032 cebador 1 (cbhA amplificación), 5 & # x02032 CCCGGGATTAACTGTTTGTGCGCTAT 3 & # x02032 cebador 2 (cbhA amplificación), 5 & # x02032 TCTAGAGCTCTTATCGATATGGCAATTC 3 & # x02032.

Hibridación del sur.

La sonda contra el 5 & # x02032-end 0.4 kb del T. saccharolyticum xynA El gen se generó usando un kit de marcaje de PCR-DIG (digoxigenina) (Boehringer Mannheim) de acuerdo con las instrucciones del fabricante. La mezcla comercial de nucleótidos que contenía dUTP marcado con DIG se diluyó a la mitad con una mezcla de nucleótidos no marcada para aumentar el rendimiento del producto. Las secuencias de los dos cebadores fueron 5 & # x02032 ATCGTCTAGATAGTGTCAGTGGTT 3 & # x02032 (cebador 1) y 5 & # x02032 TCATCCATGGTGCTTGTTCAGTAG 3 & # x02032 (cebador 2).

Ensayo enzimático.

La actividad mananasa se determinó a pH neutro utilizando galactomanano azocarrobiano como sustrato. El sustrato sin cortar se precipitó con etanol 95 & # x00025 y se centrifugó, y la cantidad de colorante liberado en el sobrenadante se midió a 590 nm según las instrucciones del fabricante (Megazyme, Sydney, New South Wales, Australia), usando una curva estándar generada para el lote específico. Las actividades de endoglucanasa, celobiohidrolasa y exoglucanasa se determinaron midiendo la cantidad de azúcares reductores liberados de 7L CMC (carboximetilcelulosa) (Hercules, Wilmington, Del.), Celulosa hinchada con ácido, Avicel o celulosa cristalina, empleando el pagensayo de hidrazida de ácido -hidroxibenzoico como lo describe Lever (11), usando glucosa para la preparación de curvas estándar. Adicionalmente, pag-nitrofenol - & # x003b2- d -celobiósido se utilizó como sustrato para la celobiohidrolasa, y la liberación de pag-nitrofenol se determinó a 405 nm como se describió anteriormente (27). Las actividades enzimáticas se determinaron a pH neutro y se expresan en unidades definidas como la formación de 1 & # x003 bcmol de producto por minuto a 60 & # x000b0C. Las actividades específicas se dan en unidades por miligramo de proteína (determinadas por el ensayo de Bradford).


MATERIALES Y MÉTODOS

Cepas y condiciones de crecimiento.

Streptococcus mutans las cepas se cultivaron a partir de colonias individuales en caldo BHI (Difco). A menos que se indique lo contrario (aquí o en el Texto S1 en el material complementario), S. mutans se cultivó rutinariamente a 37 & # x000b0C en un 5% de CO2 Atmósfera aeróbica. Escherichia coli las cepas se cultivaron rutinariamente en caldo LB (10 g / litro de triptona, 5 g / litro de extracto de levadura y 5 g / litro de NaCl) a 37 ° C con aireación. Se agregaron antibióticos a los medios de crecimiento a las siguientes concentraciones: espectinomicina, 1.0 mg / ml para S. mutans y 50 & # x003bcg / ml para E. coli kanamicina, 1,0 mg / ml para S. mutans, 500 & # x003bcg / ml para S. gordoniiy 50 & # x003bcg / ml para E. coli ampicilina, 100 & # x003bcg / ml para E. coli. En el material suplementario se pueden encontrar listas de cepas y plásmidos (Tabla S3) y cebadores de oligonucleótidos (Tabla S4).

Construcción de la biblioteca de transposones.

Un in vitro Se utilizó el protocolo de mutagénesis de transposones para mutagenizar aleatoriamente el ADN cromosómico purificado de S. mutans UA159 (20). Brevemente, la transposasa MarC9 (47, 48) se purificó a partir de E. coli pMalC9 (ver texto S1). MarC9, S. mutans ADN genómico y plásmido pMagellan6, que alberga el marinero Himar1 derivado de minitransposón magellan6, se combinaron e incubaron durante 1 ha 30 ° C. Una vez reparadas las uniones de transposones, los fragmentos de ADN genómico que contienen magellan6 inserciones se transformaron en competentes S. mutans. Los mutantes de transposón se seleccionaron en agar BHI que contenía antibióticos relevantes después de 48 h de incubación. Las colonias se retiraron de la superficie del agar, se resuspendieron en caldo BHI y se centrifugaron a 3500 & # x000d7 gramo durante 10 min a 4 & # x000b0C y luego se resuspendió en 5 ml de caldo BHI con glicerol (glicerol al 25%) y se dividieron en alícuotas en volúmenes de 250 - & # x003bcl para almacenamiento a largo plazo a & # x0221280 & # x000b0C.

Pantalla basada en placas para mutantes que no se activan comX transcripción.

Las reservas de glicerol de la biblioteca se descongelaron en hielo y luego se diluyeron 1:50 en caldo BHI nuevo. Las muestras se incubaron hasta la DO600 fue igual a 0,1 y luego se diluyó a 1:10 5. Se esparcieron alícuotas de cien microlitros en agar TYG & # x02013X-Gal (2 g / litro de glucosa, 10 g / litro de triptona, 5 g / litro de extracto de levadura, 3 g / litro de K2HPO4, 15 g / litro de agarosa, 50 & # x003 bcg / ml X-Gal). Las placas se incubaron durante 2 días a 37 ° C en un 5% de CO2 incubadora. Se recogieron colonias blancas y se cultivaron durante la noche en caldo BHI, y se prepararon reservas de glicerol y se almacenaron a & # x0221280 & # x000b0ºC. Cepas con P aparentemente bajocomX-lacZ A continuación, se examinó la actividad para detectar defectos de competencia genética y cepas con fenotipos diferentes a los de S. mutans UA159 se secuenció con PCR arbitraria para determinar los sitios de inserción del transposón (para obtener detalles sobre el método, consulte el Texto S1).

Tn-seq.

Se descongeló una alícuota del conjunto de bibliotecas de transposones y se diluyó 1: 100 en 50 ml de caldo BHI o en 50 ml de caldo BHI más CSP 2 & # x003bcM. Las muestras se cultivaron a una DO600 de 1,0 y luego se transfirió a caldo BHI fresco o BHI-CSP para un total de 5 pases. Los recuentos viables totales antes y después de la incubación se enumeraron mediante placa en agar BHI. Después de cada pase, se recogió una muestra de 10 ml para la preparación de ADN genómico. El ADN genómico se extrajo utilizando el kit de purificación de ADN Gram Positivo MasterPure (Epicenter Biotechnologies) de acuerdo con las instrucciones del proveedor, con modificaciones menores (49). La digestión de restricción del ADN genómico, la ligadura del adaptador de Illumina, la amplificación por PCR de la biblioteca y la secuenciación de Illumina se realizaron como se describió anteriormente (20, 22). Las bibliotecas se secuenciaron en la instalación central de secuenciación de ADN NextGen en la Universidad de Florida en un NextSeq 500 (Illumina) con una lectura de secuenciación de un solo extremo de 75 pb (1 & # x000d7 50 ciclos). Consulte el texto S1 para conocer los análisis bioinformáticos de Tn-seq.

Ensayos fenotípicos y análisis de conglomerados.

El texto S1 detalla los criterios y metodologías empleados para validar genes que regulan la competencia genética putativa, incluidos ensayos de transformación, estudios de crecimiento y P unicelularcomX-gfp investigaciones de reporteros.


¿Las bacterias almacenadas perdieron plásmidos? - (06 / Febrero / 2009)

Estoy teniendo problemas repetidos con algunos clones de vectores bacterianos y de citocinas. Hice la mayoría de estos hace un año (todo bien) y congelé copias de ellos en reservas de glicerol (nunca antes fue un problema). cuando las crío frescas, obtengo colonias (aproximadamente 20) pero cuando las liso y las pcr, no obtengo ningún producto o un producto débil que cuando se miniprep (Qiagen) y se prueba en PCR en tiempo real no tiene nada & # 33 He hecho PCR de estos minipreps y no obtenga ningún producto. También probé un nuevo kit de minipreparaciones, caldos y agares frescos, tampón de lisis, etc. Todavía tengo algunas cosas que puedo probar, y voy a enviar una de estas minipreparaciones para secuenciar, pero me preguntaba si alguien había tenido problemas similares para una solución rápida & # 33
Me han dicho que podría ser que mi plásmido se haya caído del vector, sin embargo, tengo el mismo problema con varios clones diferentes y no creo que hubiera ocurrido el mismo problema en todos ellos.

Gracias por su atención,

No veo por qué tuviste que preservar los plásmidos con glicerol. Esa podría ser una de las razones de la muy baja eficiencia de transformación. (Lo sé por la experiencia de alguien que, sin saberlo, había resuspendido plásmidos en 50% de glicerol y nunca volvió a tener colonias). Y en caso de que sean los cultivos que ha conservado en glicerol. La nueva transformación del plásmido debería funcionar.
Buena suerte

Cuando dices que congelaste copias en reservas de glicerol, te refieres a que hiciste reservas de glicerol de la bacteria, ¿verdad? Y luego vuelves a romper el stock de glicerol bacteriano, ¿verdad? De todos modos, mis reservas de glicerol nunca producen mucho ADN, si es que lo hay. Obtendré colonias, me expandiré y prepararé y me sentiré afortunado si puedo obtener hasta 50 ng / ul. No estoy seguro de por qué o qué estoy haciendo de manera diferente, ya que todos los demás en el laboratorio usan estas cepas, pero siempre tengo que volver a transformar el ADN para obtener buenas preparaciones de ADN. Ahora, en lugar de reservas de glicerol, tengo una caja de "ADN de reserva" con 20 ul de cada clon. Cuando necesito amplificar, simplemente vuelvo a transformar 0.5ul. Vea si puede amplificar con una nueva transformación. Si no es así, entonces tiene un problema grave.

KatieB el 6 de febrero de 2009, 04 & # 5846 AM dijo:

Estoy teniendo problemas repetidos con algunos clones de vectores bacterianos y de citocinas. Hice la mayoría de estos hace un año (todo bien) y congelé copias de ellos en reservas de glicerol (nunca antes fue un problema). cuando las crío frescas, obtengo colonias (aproximadamente 20) pero cuando las liso y las pcr, no obtengo ningún producto o un producto débil que cuando se miniprep (Qiagen) y se prueba en PCR en tiempo real no tiene nada & # 33 He hecho PCR de estos minipreps y no obtenga ningún producto. También probé un nuevo kit de minipreparaciones, caldos y agares frescos, tampón de lisis, etc. Todavía tengo algunas cosas que puedo probar, y voy a enviar una de estas minipreparaciones para secuenciar, pero me preguntaba si alguien había tenido problemas similares para una solución rápida & # 33
Me han dicho que podría ser que mi plásmido se haya salido del vector, sin embargo, tengo el mismo problema con varios clones diferentes y no creo que hubiera ocurrido el mismo problema en todos ellos.

Gracias por su atención,

Esto generalmente no sucede con las reservas de glicerol bacteriano, incluso si se maneja mal, pero es posible que desee pensar en lo siguiente:

1. Que está usando los antibióticos correctos (a veces se olvida que era resistente al kan, no al ampR)

2. Asegúrese de que la congelación no se haya roto durante un período prolongado durante el último año.

3. Los plásmidos no se caen, pero si en el momento de congelarse, si los ha cultivado durante mucho tiempo en ausencia de antibiótico, es posible que se hayan caído.

4. Verifique sus reactivos actuales. Que ya hiciste & # 33

5. Como hay un problema, sugiero sembrar las células primero en placas libres de Ab o incluso cultivarlas en medio líquido durante una hora sin Ab. En caso de que la dosis del gen de resistencia haya bajado.

Es posible que algunas reservas de glicerol se echen a perder (no hay colonias después del rayado), pero es muy, muy raro. Por supuesto, se sospecha que el protocolo para estas reservas de glicerol podría haber tenido algún error o en la preparación de las reservas. Espero que los haya tenido en cuenta.

Vuelva a comprobar todas las soluciones e intente cultivar directamente un cultivo líquido (sin antibióticos) a partir de las reservas de glicerol.

Hola
Gracias por todos estos comentarios. He usado este mismo método de reserva de glicerol durante años (sí, me refiero a la inoculación de un frasco de congelador con caldo y glicerol al 10%) y no he tenido ningún problema, y ​​mi congelador se ha mantenido constante a -80 todo el tiempo.
También he hecho clones frescos que tienen exactamente el mismo problema, por lo que no pueden ser mis reservas de glicerol, debe ser algo en los medios. He preparado ampicilina fresca (este es el antibiótico adecuado para los vectores pGEM T-easy).

rkay447 - dijiste que en su lugar tenías una caja de reserva de ADN - ¿es esto solo ADN puro, productos de PCR o ADN en un vector (¿se puede mantener a largo plazo?)? Utilizo ADN bacteriano amplificado purificado para mi clonación y siempre he pensado que los productos de PCR purificados no deberían conservarse para su uso durante más de un par de semanas.

Intentaré cultivar sin ampicilina para ver si hay alguna diferencia. Am also just going to throw everything out AGAIN and start fresh again! always a good method when something randomly goes wrong in the lab I find! i'll keep you posted!

KatieB on Feb 9 2009, 06ᛙ AM said:

If the plasmid is prepared well it can be kept for over a decade.
PCR products and DNA fragments can be kept in a form usable for DNA ligation for over 2 years at -20 C. There is some lost in efficiency but not much.

There are two way one can keep a plasmid.

1 - keeping an e coli strain containing the plasmid
2 - keeping the plasmid as pure DNA.

I prefer keeping my plasmids as DNA. A large quantity of DNA can be kept, so the probability of losing the plasmid (even in situations of power outage and repeated freeze thaw cycles) is small.

You can also spot the plasmids on 3M paper, put it in a plastic sheet, and keep a notebook that way. Our neighbour lab supervisor has an album of such plasmids.

She has made multiple marked spots on each 3M sheet, and whenever someone requests plasmids, she just cuts a sqaure and sends it. She has been keeping it this way for over a decade now.

cellcounter on Feb 9 2009, 01ᚨ PM said:

You can also spot the plasmids on 3M paper, put it in a plastic sheet, and keep a notebook that way. Our neighbour lab supervisor has an album of such plasmids.

She has made multiple marked spots on each 3M sheet, and whenever someone requests plasmids, she just cuts a sqaure and sends it. She has been keeping it this way for over a decade now.

cellcounter on Feb 10 2009, 06ᚨ AM said:

You can also spot the plasmids on 3M paper, put it in a plastic sheet, and keep a notebook that way. Our neighbour lab supervisor has an album of such plasmids.

She has made multiple marked spots on each 3M sheet, and whenever someone requests plasmids, she just cuts a sqaure and sends it. She has been keeping it this way for over a decade now.


Resumen

En silico analysis of the Bifidobacterium breve UCC2003 genome predicted two distinct loci, which encode three different restriction/modification systems, each comprising a modification methylase and a restriction endonuclease. Based on sequence homology and observed protection against restriction we conclude that the first restriction endonuclease, designated BbrI, is an isoschizomer of BbeI, the second, BbrII, is a neoschizomer of SalI, while the third, BbrIII, is an isoschizomer of PstI. Expression of each of the B. breve UCC2003 methylase-encoding genes in B. breve JCM 7017 established that BbrII and BbrIII are active and restrict incoming DNA. By exploiting knowledge on restriction/modification in B. breve UCC2003 we successfully increased the transformation efficiency to a level that allows the reliable generation of mutants by homologous recombination using a non-replicative plasmid.


3. A Dramatic Shift in the Application of Genetic Approaches to Mosquito and Mosquito-Transmitted Disease Control: Perspectives on the Future

Clearly, the technology described here is not to be used lightly. Given the suffering caused by some species, neither is it obviously one to be ignored.& # x0201d

The application of Cas9 to gene drive represents a second major shift in the field of vector genetics for disease control. It is now technically straight-forward to develop any number of genetic strategies and so add a substantial new subset of tools to vector control efforts ( Figure 1 ), so how do we use CRISPR/Cas9 and similar technologies for gene editing and gene drive given the enormous potential to alleviate human suffering? Challenges will arise in efforts to implement molecular techniques developed in the lab to field releases. We will do well to heed the lessons learned by previous work and to carefully consider the challenges that have emerged alongside the introduction of efficient, site-specific gene-editing.

3.1. Long-Standing Considerations

3.1.1. Early Successes Provide Templates for Predicting Success

Sterile insect technique and genetics-based control tools were first tested in mosquito populations in the 1960s. Initial field trials with Un. cuadrimaculato, Ae. aegypti y Cx. pipiens fatigans failed to control test populations and it was only when chemosterilization with the chemical agent thiotepa replaced radiation as the primary means to sterilize males, that the switch in methods led to the first successful mosquito SIT program [202,203,204,205,206]. Chemosterilized Cx. pipiens eliminated the native population after 10 weeks of sterile male releases in Seahorse Key (FL, USA) [202]. These early successes and failures suggest that vector control tools that look promising in the laboratory don’t always translate into promising outcomes in the field. Better means to predict field success are needed. Compared to laboratory studies, wild populations may be more likely to experience density-dependence and the effect of released sterile males could be reduced by migrating inseminated females from outside of the release area [203]. Early modeling efforts to predict the success of sterile male release programs suggested that even modest immigration of mosquitoes into a release area could doom a population suppression program to failure, leading Asman and others to conclude that “with immigration, eradication is not possible and continued sterile male release would be required in order to maintain tolerable low levels of the pest” [200]. In contrast, population modification strategies are likely more resilient to immigration of mosquito populations into and out of a release area and the replacement rate can be predicted by the fitness differences between the released mosquito and wild-type [203]. Although gene drive mechanisms exhibit non-Mendelian inheritance patterns and can likely tolerate more fitness costs than mechanisms with Mendelian inheritance, fitness still plays an important role in predicting success of population suppression or modification [139,207,208,209].

Not surprisingly, we can still largely depend on a 50-year-old framework for assessing the potential of a mechanism prior to implementation, considerations for release and evaluating the outcomes. Perhaps the most important appeal to be made of researchers is to aggressively collect data. Recommendations that data be collected on the disease and vector biology, environment and population dynamics of the targeted insect, the fitness and thus competitiveness of released strains compared to wild populations, and the rearing and handling requirements strategy are in every milestone assessment review on the topic of genetic control of insects and cannot be underemphasized in the context of gene drive [20,23,53,210,211,212,213,214]. The drive rate, tolerable fitness reductions, tolerable levels of drive-resistance, and optimal distribution and timing for successful release need to be modeled with field-relevant parameters to predict success of a release program. Ongoing surveillance data will be critical to interpreting the success of release strategies, identifying useful modifications to an approach including replacement of a drive-strategy, and determining whether a reversal of the drive is necessary.

3.1.2. Identify and Measure Appropriate Proxies for Assessing the Fitness of a Treatment Strain

Understanding the contribution of the fitness of specialized mosquitoes relative to the wild target population is pivotal to predicting the success of a genetic strategy for vector control, since the transfer of genetic material from released mosquitoes to offspring in the wild depends on competition with wild mosquitoes for resources and mating. Most genetics-based control strategies are first tested in cage trials, where population modification or suppression can be observed under different ratios of genetically modified individuals to unaltered individuals, and under conditions where life history traits can be carefully measured and environmental variables such as resource availability, temperature and humidity can be controlled. Standard laboratory assessments prior to field release of a genetically altered insect include measuring mating competitiveness, but rarely are more holistic measurements of fitness captured [214,215]. While unsuccessful cage trials can signal when a technology will likely fail in the field, a successful cage trial does not always translate into field success. Even within the laboratory, trial-to-trial variability is sometimes only explained by looking at fitness parameters across the insect lifespan. In 1973, trials with Drosophila testing population replacement of a laboratory population with modified strains that had compound autosomes, demonstrated that predicting successful versus unsuccessful strains required more holistic estimates of fitness than egg hatch rate alone [211]. Similarly, failed field releases of irradiated Ae. aegypti males for population suppression in Pensacola, Florida was later attributed to poor survival in the pupal stage, again highlighting the need for thorough evaluation of the consequences of sterilization or genetic-alteration on mosquito fitness across life stages prior to release [205,214]. Failed release programs have the consequence of not only wasting resources, but threatening the success of future programs by creating public mistrust or donor reluctance in supporting these types of technologies.

Evaluating fitness costs of gene drive technologies involves estimating fitness by measuring life history traits across the mosquito life cycle, or tracking allele frequencies in populations over time. Both approaches are difficult. The best fitness proxies to estimate mosquito fitness have not been clearly identified, but life history theory suggests that fitness is more sensitive to life history traits that describe early life events such as egg hatching rates and larval survival than to late-life traits such as adult survival. Juvenile traits should therefore be prioritized as the most predictive life history traits in estimating fitness when evaluating the potential for a gene drive to spread. Once spread, the impact of the drive mechanism on mosquito fitness can be used to understand potential evolutionary responses of mosquitoes to the drive mechanism and co-evolutionary changes in the parasite populations they spread. Even a drive mechanism that comes with minimal fitness costs to the mosquito could fail to reduce disease incidence or prevalence if it affects vector competence while only minimally changing vectorial capacity [216]. Understanding both vector and parasite fitness traits and their potential to evolve in response to genetics-based technologies should be understood prior to releasing these technologies into the field. A combination of computer simulations, laboratory studies that evaluate fitness parameters across the mosquito lifespan, an understanding of local ecology, and ongoing surveillance after release programs begin will be important to a robust deployment of genetics-based control.

3.1.3. The Importance of Modeling

Modeling allows us to integrate large amounts of collected data and logically draw conclusions that are not always intuitive to predict success or failure of a release program. This is especially important for identifying the ability of a genetic approach to work across different mosquito-pathogen systems. Models demonstrating the potential of certain gene drive strategies have given us reason for both optimism and concern [210,217,218,219,220]. Working from a perspective that different drive approaches will be optimal for different applications, Eckhoff modeled the vector and drive mosquito population outcome using different gene drive strategies in specific locations (Tanzania and Garki) with varying homing rates and fitness reductions [217]. Optimism for gene drive is supported by their suggestions that even the most challenging situations stand to benefit from a gene drive strategy if a certain set of qualifications are attained. With very high homing rates demonstrated for recently developed drives, it is realistic that such qualifications can be met, even with a fitness reduction in transgenic drive insects [217]. Eckhoff identified major unknowns in their studied locations including aestivation behavior of vectors and movement of males, and differences between such behaviors between vector and transgenic drive insects that would inform the success of a release program. Since multiple vectors and species complexes contribute differently to disease transmission, modeling will also serve to inform which species are most important to target in a given region in order to have the greatest impact, which will in turn inform the lab-based efforts to develop appropriate drives for each species.

3.1.4. Which Tools, Where

The complexity of vector-borne disease transmission dynamics across the globe means that a successful global eradication strategy, a current goal for both malaria and lymphatic filariasis, will require a diverse tool set and region-specific vector control application of a subset of those tools [221,222,223]. The current toolkit includes insecticide-treated bed nets (LLINs), anti-malarial and anti-filarial drugs, a yellow fever virus vaccine, indoor residual spraying, structural modifications to housing (improved housing material, screens, eave-tubes), larval habitat treatment, Wolbachia-based gene drive (Eliminate Dengue), Wolbachia-based population suppression (MosquitoMate and Verily), and a transgenic RIDL strain (release of individuals carrying a dominant lethal, flightless female strain OX513A) ( Figure 1 ). This toolkit is growing to soon include additional arbovirus and malaria vaccines. Some tools, specifically those dependent on pyrethroids and other insecticides, are becoming less useful due to growing insecticide-resistance [88,224,225,226,227,228]. The variety of genetic tools currently in development since the advance in genetic technologies can target many aspects of mosquito and pathogen life cycles and have real potential to improve this toolkit ( Figure 1 ). Theoretical analyses that have evaluated added benefits from combining vector control tools have suggested that some combinations are more effective than others. For example, LLINs in combination with larvicides are predicted to result in greater reductions in mosquito abundance than the use of LLINs with IRS or LLINs alone [229]. In practice, combined use of BT with LLINs has reduced the incidence of malaria infection to a greater extent than LLINs alone in western Kenya [230]. Similar analyses and field experiments should be done to evaluate how genetic technologies will work in combination with other existing vector control measures the inclusion of newly available and/or underutilized technologies in these analyses will greatly benefit our ability to achieve local elimination and global eradication goals. Specifically, identifying the vector control approach or approaches that most greatly impact disease transmission will provide useful direction in releasing specialized mosquito strains (transgenic or Wolbachia-infected) in areas where they best complement current approaches and have maximal effect in reducing disease.

3.2. New Considerations

3.2.1. Gene drive Resistance

New considerations regarding the potential for drive-resistance have arisen from the molecular mechanisms of site-specific endonucleases. Homing endonucleases- and Cas9-based gene drives generate resistance because the double-stranded break necessary for HDR-mediated insertion of the drive construct is occasionally repaired by using non-homologous end joining (NHEJ) instead. Repair by NHEJ often causes insertions or deletions in the target site, rendering it impervious to future targeting by the endonuclease. When HEGs were first proposed as a site-specific gene drive, it was recognized that variation and mutation in the sequence of the target site would provide a source of resistance to the drive, but also that strategic drive design would likely lead to successful gene drive [75,231]. Recent modeling of sources of sequence variation, both naturally occurring and induced by the drive mechanism itself, suggest that resistance will almost certainly emerge to a simple one-target Cas9-based gene drive [219]. Even modest rates of NHEJ are likely to impact the effectiveness of gene drive strategy [217,219,232,233] in order for a gene drive to be successful, the emergence of resistance to the drive must be at least five orders of magnitude lower than what have been observed in recently demonstrated drives [163,164,165,179]. Gene drives based on site-specific endonucleases rely on the repair mechanism of the organism, so that it may be difficult to engineer a gene drive scenario that manipulates that host-biology such that HDR is favored over NHEJ to such an extent as to provide orders of magnitude fewer occurrences of resistant alleles. Approaches to mitigate the effects of gene drive resistance have been suggested, including targeting multiple sites for disruption, targeting highly conserved sites or sites where indels caused by NHEJ would cause lethality or infertility, and altering the promotors and genomic targets of a gene drive. Recent investigations into these suggestions provide optimism that shortcomings of single-target Cas9-based gene drives can be overcome in future gene drive designs [179,232,233,234,235]. Multiplexed gene drives are expected to substantially decrease the likelihood of gene drive resistant alleles emerging using only a few additional targets [232]. Feasible ways to multiplex Cas9-based gene drives have been demonstrated using post-transcriptional processing of several sgRNAs expressed from a single promoter, but these have not yet been applied to mosquitoes [232,234,236,237,238].

Ambos Wolbachia-based and transgene-based approaches to vector control, including MEDEA- or transposon-based drives and transgenic population suppression strains, face the risk of becoming inert due to effector inactivation. Some data suggests that mosquito immune responses to Wolbachia prime the mosquito against viruses, like dengue, but this response could weaken over time as wMel and Ae. aegypti co-evolve, dampening refractoriness to RNA viruses [239,240]. Wolbachia-based population modification targets a rapidly evolving virus, which could change to avoid the mechanism causing refractoriness in Wolbachia-infectado Ae. aegypti. Because the biology of these interactions is largely unknown, it is prudent to closely monitor the refractoriness of mosquito populations that have been modified with wMel infection. Concern has been raised that Ae. albopictus populations targeted for suppression using Wolbachia cytoplasmic incompatibility phenotypes could become resistant to the suppression mechanism, derived from demonstrations that mosquitoes that have low abundance of the natural strains of Wolbachia are not completely sterile when they mate with wPip infected mosquitoes [241]. Such mosquitoes do exist in the targeted populations and depending on how many wPip-infected females escape sexing during rearing, wPip may become established in the wild population, rendering the strategy useless [241]. However, recent developments in sex separation techniques will likely improve the proportion of females released to address this issue [226]. Transgenes and transgenic gene drives could face a different type of inactivation. Similarly to Wolbachia, pathogen blocking could become ineffective because of pathogen evolution. Transgenic approaches have an advantage over Wolbachia in this case because the biology of pathogen blocking is known and encoding numerous targets for the pathogen can reduce the development of pathogen resistance to products of the transgenic construct. Alternatively, a transgenic drive mechanism could become unlinked from the effector genes, so that the drive continues, but the pathogen blocking alleles could be lost from the population this can be mitigated by thoughtful arrangements of the drive and effector components of a synthetic construct such that the drive becomes inactivated if the construct is disrupted by recombination [70]. Further, we know that many organisms inactivate selfish genetic elements using the piRNA pathway. While this has not been examined in mosquito transgenic lines the component of these pathways do exist in mosquitoes [242,243,244] and examples of transgenic constructs becoming piRNA producers with inhibited gene expression exist in Silkworm cell lines and in Drosophila [245,246,247,248,249,250]. We appeal to the broader vector biology field to study the underlying processes of the Wolbachia-mediated virus refractoriness and transgene inactivation and at the risk of being redundant are hopeful that these biological processes will be easier to probe with the application of reverse-genetics by site-specific gene editing.

3.2.2. Off-Target Effects of the Cas9/sgRNA Complex

Potential off-target activity of the Cas9 due to homology between sgRNAs and non-target sites in the genome presents an interesting challenge for Cas9-based gene drive. Off-target effects are not a Cas9 specific concern: RNA interference (RNAi) methods utilizing the micro- and small interfering-RNA (miRNA and siRNA respectively) also rely on ribonucleoprotein activity and are prone to inhibiting transcripts other than the intended target. An understanding of ribonucleoprotein complex characteristics and homology-based cleavage requirements have enabled researchers to faithfully use RNAi in genetics, but similar considerations for optimizing sgRNAs for use with Cas9 have not been completely teased out. To date unintended mutations induced by Cas9 have been difficult to detect and quantify. In general, genome sites with potential for off-target cleavage by a given sgRNA/Cas9 complex can be predicted using computational algorithms and then probed for mutations by PCR-based assays or larger units of genetic material (DNA or cDNA) can be deep-sequenced for indels or single nucleotide polymorphisms (SNPs) [251,252]. However, Cas9-induced off-target SNPs can be difficult to quantify accurately without a robust dataset documenting all SNPS already existing in a population to reduce false identification of off-target mutations. In mosquitoes, as in other organisms, efforts have not led to any detectable, off-target Cas9-induced mutations but a thorough analysis in mosquitoes has not yet been reported. Efforts underway by the Un. Gambiae 1000 genomes project to build a genome data set from wild-caught mosquitoes will aid in detecting potential off-target effects [159,191,253,254,255]. Other methods for detecting off-target activity of Cas9 include assays for identification of double stranded breaks or genome binding of a Cas9/sgRNA complex with inactivated nuclease activity, though these methods have not yet been used in mosquitoes [256,257,258]. Rare unintended mutations have been identified in mouse studies and notably, off-targeting in in vitro studies has been more highly reported, likely because many more genomes exposed to the Cas9/sgRNA complex are sequenced, giving the researchers a higher power to detect very rare off-target mutations [252,257,258,259,260,261].

The impact of unwanted mutation for gene drive applications is higher than for in-lab gene editing since mutations arising after release of a gene drive into a population have the potential to persist. In the case of a gene drive that is self-limiting, like those proposed for population suppression, the mistakes would be eliminated with the population itself. Off-target mutations are another source of potential fitness effects in gene drive mosquitoes designed for population modification strategies. These considerations fall squarely under the category of “unintended consequences” of the release of transgenic organisms with a drive mechanism, a common topic in academic, political and lay discussions on the utility and ethical considerations of gene drive. It thus behooves us to be able to quantify and model the possibility of introduction of mutations derived by off-targeting of the drive components into the target mosquito populations. This will require a thorough sampling of the genomes that exist in the target population and continued sampling of genomes after release of gene drive laden mosquitoes with the specific intention of detecting new, unintended mutations.

It may be that such quantification will provide an increased confidence in the Cas9-based gene drive strategies already in development. However, should prudence require increased specificity in nuclease activity, approaches to increase specificity and efficiency of the RNA-guided endonuclease have already been demonstrated to be effective, including truncation of the sgRNA, the use of Cas9 nickases (a Cas9 mutant that only cuts a single DNA strand) with offset target sites, highly-specific Cas9 mutants like eSpCas9 and SpCasp-HF1 and alternate RNA-guided nucleases like Cpf1 that create sticky double stranded breaks [251,257,262,263,264,265,266,267]. Algorithms for sgRNA design are updated regularly to incorporate both new knowledge on off-target effects and increasing number of genomes in order to generate specific and efficient sgRNAs [268,269]. The measuring and addressing off-target effects and their potential impacts on gene drive strategies are areas that will continue to require a substantial amount of attention.

3.3.3. Containing an Efficient Gene drive

The likelihood that a gene drive cassette would persist in the environment in the case of accidental release from lab containment, a test site or a rearing facility has been modelled between different drive mechanisms and depends variably on the number of mosquitoes released and the efficiency of the drive [270]. The novelty of the levels of efficiency observed for recent applications of CRISPR/Cas9 biology requires a re-consideration of the potential to control the activity of the gene drive both during experimentation in the lab with the possibility of accidental release and once intentionally released into the wild for disease control applications. A high level of care when working with gene drive constructs has been echoed through the field as essential to the ethical development of the CRISPR/Cas9-based technology for all potential applications [235,271,272,273]. In addition to gene drive containment recommendations, several mechanisms to reverse a drive following the intentional releases are being developed. These strategies are particularly relevant for population modification strategies, since population suppression strategies are inherently limited. The Cas9/sgRNA complex and HEGs have both been proposed as the basis of both reversal mechanisms including designs for synthetic constructs driven in trans by another construct, even in several iterations (called �isy chains”), in order to limit the spread of independent self-driving constructs in the case of an accidental release [75,152,274,275]. Such systems have been demonstrated in yeast and modelled to provide a robust and containable drive mechanism [275].

3.3.4. Globalization

Globalization impacts vector control strategies in two foreseeable ways. First, mosquitoes released for population suppression and replacement efforts disperse without regard to political boundaries. In an age of increasing global movement by humans, dispersal of genetically-altered mosquitoes outside of intended release zones is inevitable. Genetics-based control efforts will have to evaluate how to contain genetically-altered mosquitoes in population replacement programs, and deploy intensive surveillance for population suppression efforts to avoid migration into and out of the release zones when there are concerns over unintended consequences. For suppression programs, migration into a release area or an area that has already achieved local elimination could result in repopulation of the mosquitoes we were trying to control. For population modification strategies, dispersal of released mosquitoes outside of intended areas could create political tensions with bordering countries that may not have approved the technology. Improved molecular tools, buffer zones with alternative control strategies near political borders, remote sensing of mosquitoes with improved traps or acoustic identification technology [276], or citizen scientist campaigns to detect or sample local mosquitoes could all contribute to more effective and contained vector control campaigns. To address concerns of population replacement campaigns resulting in new populations susceptible to new diseases, improved xenosurveillance and future efforts to make surveillance faster and easier will likely make any unintended consequences quickly detectable and easier to address [277].

Second, rapid globalized human communication is a novel tool for complex vector management approaches and can be leveraged to integrate the various levels of information that will influence the planning, implementation, assessment and adjustment of a strategy, including information on the population structures of target regions, current release efforts, surveillance of specialized mosquito strains following release and resulting epidemiological changes. Many release strategies are being tested around the world, with only minimal available information in these categories. Eliminate Dengue has a map indicating sites where wMel-infected mosquitoes are being released with links to the progress made in those areas. Oxitec and MosquitoMate have information about ongoing releases of transgenic line OX513A Ae. aegypti y wPip-infected Ae. albopictus respectively, but without interactive maps [227,278]. Verily Life Sciences will begin releases of wAlbB-infected Ae. aegypti in California and Queensland soon. Releases of sterile Un. arabiensis are ongoing in South Africa and Sudan [279,280]. Test releases of sterilized Ae. aegypti have been conducted in Italy, Indonesia, Mauritius and China and, Wolbachia-laden Un. polynisiensis y Cx. pipiens quinquefasciatus are being tested in for cytoplasmic incompatibility in French Polynesia for lymphatic filiariasis control and La Reunion for arbovirus control, respectively [281]. Optimally, data collected in concurrence with these releases could be integrated into a single framework. VectorBase.org is particularly well poised to undertake these efforts vector genetic information contributed by scientists is integrated and openly available to others. Mosquito insecticide resistance is being collected in this database, is accessible also as interactive map, and is being expanded to include additional phenotypes of existing mosquito populations [282]. Further expansion including transgene information and Wolbachia-infection status overlaid with epidemiological data such as those presented by internet disease surveillance sites like healthmap.org and the Malaria Atlas Project will support release and data openness goals [283,284]. Internet-based platforms for the integration of population and epidemiological data and ongoing releases could promote the sharing of information between scientists, practitioners and policy makers and encourage an atmosphere of participation and openness among lay people.


Afiliaciones

The SATCM Key Laboratory for New Resources & Quality Evaluation of Chinese Medicine, The MOE Key Laboratory for Standardization of Chinese Medicines and Shanghai Key Laboratory of Complex Prescription, Institute of Chinese Materia Medica, Shanghai University of Traditional Chinese Medicine, Shanghai, 201203, China

Jie Shi, Jie Wang, Lu Yu, Li Yang, Shujuan Zhao & Zhengtao Wang

Department of Traditional Chinese Materia Medica, Shenyang Pharmaceutical University, Shenyang, 110016, China


Ver el vídeo: transformación bacteriana (Agosto 2022).